EMAIL THIS PAGE TO A FRIEND

CRADD

CASP2 and RIPK1 domain containing adaptor with death domain

Synonyms: MRT34 RAIDD
UniProtKB ID: P78560
Gene ID:
Human(8738) Summary: The protein encoded by this gene is a death domain (CARD/DD)-containing protein and has been shown to induce cell apoptosis. Through its CARD domain, this protein interacts with, and thus recruits, caspase 2/ICH1 to the cell death signal transduction complex that includes tumor necrosis factor receptor 1 (TNFR1A), RIPK1/RIP kinase, and numbers of other CARD domain-containing proteins. [provided by RefSeq, Jul 2008]
Mouse(12905) CASP2 and RIPK1 domain containing adaptor with death domain
Rat(314756) CASP2 and RIPK1 domain containing adaptor with death domain
Zebrafish(450046) CASP2 and RIPK1 domain containing adaptor with death domain
chicken(417900) CASP2 and RIPK1 domain containing adaptor with death domain
dog(482604) CASP2 and RIPK1 domain containing adaptor with death domain
domestic cat(101081233) CASP2 and RIPK1 domain containing adaptor with death domain
cow(615788) CASP2 and RIPK1 domain containing adaptor with death domain
domestic guinea pig(100714422) CASP2 and RIPK1 domain containing adaptor with death domain
naked mole-rat(101716016) CASP2 and RIPK1 domain containing adaptor with death domain
sheep(101115270) CASP2 and RIPK1 domain containing adaptor with death domain
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003805 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019631 MISSION® esiRNA esiRNA targeting mouse Cradd (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003805 Rosetta Predictions human pricing
NM_001108085 Rosetta Predictions rat pricing
NM_009950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168393 predicted 486
2 SASI_Hs01_00168394 predicted 290
3 SASI_Hs01_00168395 predicted 289
4 SASI_Hs01_00168396 predicted 297
5 SASI_Hs01_00168397 predicted 513
6 SASI_Hs01_00168398 predicted 511
7 SASI_Hs01_00168399 predicted 192
8 SASI_Hs01_00168402 predicted 387
9 SASI_Hs02_00336337 predicted 258
10 SASI_Hs02_00336338 predicted 315
11 SASI_Hs01_00168400 predicted 236
12 SASI_Hs01_00168401 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235204 predicted 355
2 SASI_Rn02_00235205 predicted 389
3 SASI_Rn02_00235206 predicted 355
4 SASI_Rn02_00235207 predicted 356
5 SASI_Rn02_00235208 predicted 443
6 SASI_Rn02_00235209 predicted 380
7 SASI_Rn02_00235210 predicted 536
8 SASI_Rn02_00235211 predicted 448
9 SASI_Rn02_00235212 predicted 501
10 SASI_Rn02_00235213 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041144 predicted 399
2 SASI_Mm01_00041145 predicted 494
3 SASI_Mm01_00041146 predicted 455
4 SASI_Mm01_00041147 predicted 458
5 SASI_Mm01_00041148 predicted 449
6 SASI_Mm01_00041149 predicted 413
7 SASI_Mm01_00041150 predicted 399
8 SASI_Mm01_00041151 predicted 459
9 SASI_Mm01_00041153 predicted 1072
10 SASI_Mm02_00317513 predicted 926
11 SASI_Mm01_00041152 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009950
CRADD MISSION shRNA Bacterial Glycerol Stock
CASP2 and RIPK1 domain containing adaptor with death domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009950.1-908s1c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-643s1c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-189s1c1
Sequence:CCGGGACTGGTTCTTCAGTACCTTTCTCGAGAAAGGTACTGAAGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-459s1c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-277s1c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-278s21c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-644s21c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009950.2-909s21c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-460s21c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009950
CRADD MISSION shRNA shRNA Plasmid DNA
CASP2 and RIPK1 domain containing adaptor with death domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009950.1-908s1c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-643s1c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-189s1c1
Sequence:CCGGGACTGGTTCTTCAGTACCTTTCTCGAGAAAGGTACTGAAGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-459s1c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-277s1c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-278s21c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-644s21c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009950.2-909s21c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-460s21c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009950
CRADD MISSION shRNA Lentiviral Transduction Particles
CASP2 and RIPK1 domain containing adaptor with death domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009950.1-908s1c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-643s1c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-189s1c1
Sequence:CCGGGACTGGTTCTTCAGTACCTTTCTCGAGAAAGGTACTGAAGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-459s1c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009950.1-277s1c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-278s21c1
Sequence:CCGGGACAATGCTGTTGCTGGACATCTCGAGATGTCCAGCAACAGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-644s21c1
Sequence:CCGGCACCTTCCTAAGCTTACACAACTCGAGTTGTGTAAGCTTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009950.2-909s21c1
Sequence:CCGGGCGCTGTTGTAACTATGGTTTCTCGAGAAACCATAGTTACAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009950.2-460s21c1
Sequence:CCGGCGCCATCAGACCAGCAGATTACTCGAGTAATCTGCTGGTCTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003805
VALIDATED
CRADD MISSION shRNA Bacterial Glycerol Stock
CASP2 and RIPK1 domain containing adaptor with death domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-188s1c1
Sequence:CCGGGTACCTCTACCAGGAAGGAATCTCGAGATTCCTTCCTGGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-401s1c1
Sequence:CCGGAGGTGACAGATTGACTGGGATCTCGAGATCCCAGTCAATCTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-530s1c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-299s1c1
Sequence:CCGGCCCTAAAGCATTTGATACATTCTCGAGAATGTATCAAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-854s1c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-322s21c1
Sequence:CCGGTAGATTCCCTACAGGAGTTTCCTCGAGGAAACTCCTGTAGGGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-446s21c1
Sequence:CCGGCCCATCAGACCGGCAGATTAACTCGAGTTAATCTGCCGGTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003805.3-854s21c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003805.3-530s21c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-264s21c1
Sequence:CCGGACAATGCTCCTGCTGGATATCCTCGAGGATATCCAGCAGGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003805
VALIDATED
CRADD MISSION shRNA shRNA Plasmid DNA
CASP2 and RIPK1 domain containing adaptor with death domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-188s1c1
Sequence:CCGGGTACCTCTACCAGGAAGGAATCTCGAGATTCCTTCCTGGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-401s1c1
Sequence:CCGGAGGTGACAGATTGACTGGGATCTCGAGATCCCAGTCAATCTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-530s1c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-299s1c1
Sequence:CCGGCCCTAAAGCATTTGATACATTCTCGAGAATGTATCAAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-854s1c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-322s21c1
Sequence:CCGGTAGATTCCCTACAGGAGTTTCCTCGAGGAAACTCCTGTAGGGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-446s21c1
Sequence:CCGGCCCATCAGACCGGCAGATTAACTCGAGTTAATCTGCCGGTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003805.3-854s21c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003805.3-530s21c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-264s21c1
Sequence:CCGGACAATGCTCCTGCTGGATATCCTCGAGGATATCCAGCAGGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003805
VALIDATED
CRADD MISSION shRNA Lentiviral Transduction Particles
CASP2 and RIPK1 domain containing adaptor with death domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-188s1c1
Sequence:CCGGGTACCTCTACCAGGAAGGAATCTCGAGATTCCTTCCTGGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-401s1c1
Sequence:CCGGAGGTGACAGATTGACTGGGATCTCGAGATCCCAGTCAATCTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-530s1c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003805.3-299s1c1
Sequence:CCGGCCCTAAAGCATTTGATACATTCTCGAGAATGTATCAAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003805.3-854s1c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-322s21c1
Sequence:CCGGTAGATTCCCTACAGGAGTTTCCTCGAGGAAACTCCTGTAGGGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-446s21c1
Sequence:CCGGCCCATCAGACCGGCAGATTAACTCGAGTTAATCTGCCGGTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003805.3-854s21c1
Sequence:CCGGCATTACTTGAAAGGCCAGATTCTCGAGAATCTGGCCTTTCAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003805.3-530s21c1
Sequence:CCGGGACGGATATCTACCGCTGTAACTCGAGTTACAGCGGTAGATATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003805.3-264s21c1
Sequence:CCGGACAATGCTCCTGCTGGATATCCTCGAGGATATCCAGCAGGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks