EMAIL THIS PAGE TO A FRIEND

CRAMP1L

Crm, cramped-like (Drosophila)

116 Gene Product Result for
Synonyms: HN1L TCE4
UniProtKB ID: Q96RY5, A8MZL1, B1AJY1, Q8NDN1, Q9P2C1
Gene ID:
Mouse(57354) Crm, cramped-like (Drosophila)
Rat(287127) Crm, cramped-like (Drosophila)
Zebrafish(336311) Crm, cramped-like (Drosophila)
dog(491479) Crm, cramped-like (Drosophila)
cow(520515) Crm, cramped-like (Drosophila)
domestic cat(101087034) Crm, cramped-like (Drosophila)
chicken(416762) Crm, cramped-like (Drosophila)
sheep(101109762) Crm, cramped-like (Drosophila)
Domestic Rabbit(100356852) Crm, cramped-like (Drosophila)
naked mole-rat(101714656) Crm, cramped-like (Drosophila)
domestic guinea pig(100725428) Crm, cramped-like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041752 Anti-CRAMP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_034570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_034570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_034570 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072351 MISSION® esiRNA esiRNA targeting mouse Cramp1l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020825 Rosetta Predictions human pricing
XM_001058347 Rosetta Predictions rat pricing
XM_213246 Rosetta Predictions rat pricing
NM_020608 Rosetta Predictions mouse pricing
XM_484614 Rosetta Predictions mouse pricing
XM_897768 Rosetta Predictions mouse pricing
XM_983827 Rosetta Predictions mouse pricing
XM_983911 Rosetta Predictions mouse pricing
XM_983948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032959 predicted 2333
2 SASI_Hs01_00032960 predicted 3024
3 SASI_Hs01_00032961 predicted 1939
4 SASI_Hs01_00032962 predicted 2841
5 SASI_Hs01_00032963 predicted 1810
6 SASI_Hs01_00032964 predicted 776
7 SASI_Hs01_00032965 predicted 3430
8 SASI_Hs01_00032966 predicted 1972
9 SASI_Hs01_00032967 predicted 464
10 SASI_Hs01_00032968 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289391 predicted 3102
2 SASI_Rn02_00289392 predicted 1298
3 SASI_Rn02_00289393 predicted 2752
4 SASI_Rn02_00289394 predicted 3506
5 SASI_Rn02_00289395 predicted 3548
6 SASI_Rn02_00289396 predicted 1676
7 SASI_Rn02_00289397 predicted 3416
8 SASI_Rn02_00289398 predicted 3953
9 SASI_Rn02_00289399 predicted 3133
10 SASI_Rn02_00289400 predicted 2463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374459 predicted 3945
2 SASI_Rn02_00374460 predicted 3916
3 SASI_Rn02_00374461 predicted 3976
4 SASI_Rn02_00374462 predicted 3955
5 SASI_Rn02_00374463 predicted 388
6 SASI_Rn02_00374464 predicted 615
7 SASI_Rn02_00374465 predicted 3947
8 SASI_Rn02_00374466 predicted 3855
9 SASI_Rn02_00374467 predicted 573
10 SASI_Rn02_00374468 predicted 3984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325714 predicted 3198
2 SASI_Mm02_00325715 predicted 2853
3 SASI_Mm02_00325716 predicted 2055
4 SASI_Mm02_00325717 predicted 3189
5 SASI_Mm02_00325718 predicted 3953
6 SASI_Mm02_00325719 predicted 2219
7 SASI_Mm02_00325720 predicted 2620
8 SASI_Mm02_00325721 predicted 3714
9 SASI_Mm02_00325722 predicted 3315
10 SASI_Mm02_00325723 predicted 3867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246302 predicted 823
2 SASI_Mm01_00246303 predicted 820
3 SASI_Mm01_00246304 predicted 846
4 SASI_Mm01_00246305 predicted 890
5 SASI_Mm01_00246306 predicted 818
6 SASI_Mm01_00246307 predicted 814
7 SASI_Mm01_00246308 predicted 830
8 SASI_Mm01_00246309 predicted 876
9 SASI_Mm01_00246310 predicted 915
10 SASI_Mm01_00246311 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222545 predicted 1063
2 SASI_Mm01_00222546 predicted 1072
3 SASI_Mm01_00222547 predicted 1089
4 SASI_Mm01_00222548 predicted 1145
5 SASI_Mm01_00222549 predicted 1066
6 SASI_Mm01_00222550 predicted 1069
7 SASI_Mm01_00222551 predicted 1078
8 SASI_Mm01_00222552 predicted 1124
9 SASI_Mm01_00222553 predicted 1163
10 SASI_Mm01_00222554 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278493 predicted 1016
2 SASI_Mm01_00278494 predicted 1018
3 SASI_Mm01_00278495 predicted 1040
4 SASI_Mm01_00278496 predicted 1085
5 SASI_Mm01_00278497 predicted 1015
6 SASI_Mm01_00278498 predicted 1021
7 SASI_Mm01_00278499 predicted 1028
8 SASI_Mm01_00278500 predicted 1079
9 SASI_Mm01_00278501 predicted 1108
10 SASI_Mm01_00278502 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231245 predicted 974
2 SASI_Mm01_00231246 predicted 299
3 SASI_Mm01_00231247 predicted 974
4 SASI_Mm01_00231248 predicted 995
5 SASI_Mm01_00231249 predicted 1044
6 SASI_Mm01_00231250 predicted 970
7 SASI_Mm01_00231251 predicted 979
8 SASI_Mm01_00231252 predicted 976
9 SASI_Mm01_00231253 predicted 1039
10 SASI_Mm01_00231254 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238835 predicted 297
2 SASI_Mm01_00238836 predicted 982
3 SASI_Mm01_00238837 predicted 995
4 SASI_Mm01_00238838 predicted 1045
5 SASI_Mm01_00238839 predicted 965
6 SASI_Mm01_00238840 predicted 975
7 SASI_Mm01_00238841 predicted 978
8 SASI_Mm01_00238842 predicted 1033
9 SASI_Mm01_00238843 predicted 1060
10 SASI_Mm01_00238844 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020608
VALIDATED
CRAMP1L MISSION shRNA Bacterial Glycerol Stock
Crm, cramped-like (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-880s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-3844s21c1
Sequence:CCGGGACTACATATCTCGGTTTAATCTCGAGATTAAACCGAGATATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-924s21c1
Sequence:CCGGAGCCACCACAGTACGTTATAACTCGAGTTATAACGTACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020608.3-5534s21c1
Sequence:CCGGATAACCCTGCTATCCTATAACCTCGAGGTTATAGGATAGCAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-746s21c1
Sequence:CCGGACCGCACCTGGCACAAGATTACTCGAGTAATCTTGTGCCAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020608
VALIDATED
CRAMP1L MISSION shRNA shRNA Plasmid DNA
Crm, cramped-like (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-880s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-3844s21c1
Sequence:CCGGGACTACATATCTCGGTTTAATCTCGAGATTAAACCGAGATATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-924s21c1
Sequence:CCGGAGCCACCACAGTACGTTATAACTCGAGTTATAACGTACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020608.3-5534s21c1
Sequence:CCGGATAACCCTGCTATCCTATAACCTCGAGGTTATAGGATAGCAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-746s21c1
Sequence:CCGGACCGCACCTGGCACAAGATTACTCGAGTAATCTTGTGCCAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020608
VALIDATED
CRAMP1L MISSION shRNA Lentiviral Transduction Particles
Crm, cramped-like (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-880s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-3844s21c1
Sequence:CCGGGACTACATATCTCGGTTTAATCTCGAGATTAAACCGAGATATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020608.3-924s21c1
Sequence:CCGGAGCCACCACAGTACGTTATAACTCGAGTTATAACGTACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020608.3-5534s21c1
Sequence:CCGGATAACCCTGCTATCCTATAACCTCGAGGTTATAGGATAGCAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020608.3-746s21c1
Sequence:CCGGACCGCACCTGGCACAAGATTACTCGAGTAATCTTGTGCCAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020825
VALIDATED
CRAMP1L MISSION shRNA Bacterial Glycerol Stock
Crm, cramped-like (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020825.2-4395s21c1
Sequence:CCGGGTGACCCTTAGGCGCTAATATCTCGAGATATTAGCGCCTAAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2592s21c1
Sequence:CCGGTGGCCAGTGCTATCGACTTAGCTCGAGCTAAGTCGATAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-408s21c1
Sequence:CCGGTCACCAAGTACATCGACTTTGCTCGAGCAAAGTCGATGTACTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-524s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2329s21c1
Sequence:CCGGCATCAGTATGCAGTCGGATTTCTCGAGAAATCCGACTGCATACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-1351s1c1
Sequence:CCGGCCATCAGTATGCAGTCGGATTCTCGAGAATCCGACTGCATACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-2445s1c1
Sequence:CCGGGATTACATTTCTCGGTTCAATCTCGAGATTGAACCGAGAAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020825
VALIDATED
CRAMP1L MISSION shRNA shRNA Plasmid DNA
Crm, cramped-like (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020825.2-4395s21c1
Sequence:CCGGGTGACCCTTAGGCGCTAATATCTCGAGATATTAGCGCCTAAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2592s21c1
Sequence:CCGGTGGCCAGTGCTATCGACTTAGCTCGAGCTAAGTCGATAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-408s21c1
Sequence:CCGGTCACCAAGTACATCGACTTTGCTCGAGCAAAGTCGATGTACTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-524s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2329s21c1
Sequence:CCGGCATCAGTATGCAGTCGGATTTCTCGAGAAATCCGACTGCATACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-1351s1c1
Sequence:CCGGCCATCAGTATGCAGTCGGATTCTCGAGAATCCGACTGCATACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-2445s1c1
Sequence:CCGGGATTACATTTCTCGGTTCAATCTCGAGATTGAACCGAGAAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020825
VALIDATED
CRAMP1L MISSION shRNA Lentiviral Transduction Particles
Crm, cramped-like (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020825.2-4395s21c1
Sequence:CCGGGTGACCCTTAGGCGCTAATATCTCGAGATATTAGCGCCTAAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2592s21c1
Sequence:CCGGTGGCCAGTGCTATCGACTTAGCTCGAGCTAAGTCGATAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-408s21c1
Sequence:CCGGTCACCAAGTACATCGACTTTGCTCGAGCAAAGTCGATGTACTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020825.2-524s21c1
Sequence:CCGGGATGACAAGAATGCAACAAAGCTCGAGCTTTGTTGCATTCTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020825.2-2329s21c1
Sequence:CCGGCATCAGTATGCAGTCGGATTTCTCGAGAAATCCGACTGCATACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-1351s1c1
Sequence:CCGGCCATCAGTATGCAGTCGGATTCTCGAGAATCCGACTGCATACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020825.1-2445s1c1
Sequence:CCGGGATTACATTTCTCGGTTCAATCTCGAGATTGAACCGAGAAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_034570
VALIDATED
CRAMP1L MISSION shRNA Bacterial Glycerol Stock
Crm, cramped-like (Drosophila)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000130478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_034570.5-3392s1c1
Sequence:CCGGGTAAAGAAGCAGAGCTGACTTCTCGAGAAGTCAGCTCTGCTTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-4529s1c1
Sequence:CCGGGCATTGATTACATTTCTCGGTCTCGAGACCGAGAAATGTAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-3947s1c1
Sequence:CCGGGCTCATCTGTTCTCTCCTTATCTCGAGATAAGGAGAGAACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_034570.5-3704s1c1
Sequence:CCGGCTATCGACTTAGCAGCTACAACTCGAGTTGTAGCTGCTAAGTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_034570
VALIDATED
CRAMP1L MISSION shRNA shRNA Plasmid DNA
Crm, cramped-like (Drosophila)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000130478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_034570.5-3392s1c1
Sequence:CCGGGTAAAGAAGCAGAGCTGACTTCTCGAGAAGTCAGCTCTGCTTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-4529s1c1
Sequence:CCGGGCATTGATTACATTTCTCGGTCTCGAGACCGAGAAATGTAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-3947s1c1
Sequence:CCGGGCTCATCTGTTCTCTCCTTATCTCGAGATAAGGAGAGAACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_034570.5-3704s1c1
Sequence:CCGGCTATCGACTTAGCAGCTACAACTCGAGTTGTAGCTGCTAAGTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_034570
VALIDATED
CRAMP1L MISSION shRNA Lentiviral Transduction Particles
Crm, cramped-like (Drosophila)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000130478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:XM_034570.5-3392s1c1
Sequence:CCGGGTAAAGAAGCAGAGCTGACTTCTCGAGAAGTCAGCTCTGCTTCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-4529s1c1
Sequence:CCGGGCATTGATTACATTTCTCGGTCTCGAGACCGAGAAATGTAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034570.5-3947s1c1
Sequence:CCGGGCTCATCTGTTCTCTCCTTATCTCGAGATAAGGAGAGAACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_034570.5-3704s1c1
Sequence:CCGGCTATCGACTTAGCAGCTACAACTCGAGTTGTAGCTGCTAAGTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks