EMAIL THIS PAGE TO A FRIEND

CRAT

carnitine O-acetyltransferase

92 Gene Product Result for
Synonyms: CAT1
UniProtKB ID: P43155, Q5T952, Q9BW16
Gene ID:
Human(1384) Summary: This gene encodes carnitine acetyltransferase (CRAT), which is a key enzyme in the metabolic pathway in mitochondria, peroxisomes and endoplasmic reticulum. CRAT catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acylCoA/CoA in the subcellular compartments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(12908) carnitine acetyltransferase
Rat(311849) carnitine O-acetyltransferase
domestic guinea pig(100717931) carnitine O-acetyltransferase
naked mole-rat(101706994) carnitine O-acetyltransferase
sheep(101105648) carnitine O-acetyltransferase
chicken(417195) carnitine O-acetyltransferase
cow(512902) carnitine O-acetyltransferase
Horse(100070062) carnitine O-acetyltransferase
domestic cat(101084660) carnitine O-acetyltransferase
dog(491304) carnitine O-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000755 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000755 Rosetta Predictions human pricing
NM_004003 Rosetta Predictions human pricing
NM_144782 Rosetta Predictions human pricing
NM_001004085 Rosetta Predictions rat pricing
NM_007760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128321 predicted 889
2 SASI_Hs02_00303185 predicted 1070
3 SASI_Hs01_00128323 predicted 1682
4 SASI_Hs02_00303186 predicted 1109
5 SASI_Hs02_00303187 predicted 1361
6 SASI_Hs01_00128324 predicted 695
7 SASI_Hs01_00128325 predicted 1883
8 SASI_Hs01_00128327 predicted 795
9 SASI_Hs02_00303188 predicted 1090
10 SASI_Hs01_00128328 predicted 741
11 SASI_Hs01_00128322 predicted 575
12 SASI_Hs01_00128326 predicted 902
13 SASI_Hs01_00128329 predicted 1916
14 SASI_Hs01_00128330 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186365 predicted 689
2 SASI_Hs02_00336732 predicted 870
3 SASI_Hs01_00186367 predicted 1482
4 SASI_Hs02_00336733 predicted 899
5 SASI_Hs02_00336734 predicted 1158
6 SASI_Hs01_00186368 predicted 497
7 SASI_Hs01_00186369 predicted 1676
8 SASI_Hs01_00186371 predicted 591
9 SASI_Hs02_00336735 predicted 878
10 SASI_Hs01_00186372 predicted 533
11 SASI_Hs01_00186366 predicted 377
12 SASI_Hs01_00186370 predicted 699
13 SASI_Hs01_00186373 predicted 1711
14 SASI_Hs01_00186374 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016315 predicted 900
2 SASI_Hs01_00016316 predicted 572
3 SASI_Hs01_00016317 predicted 1442
4 SASI_Hs01_00016318 predicted 703
5 SASI_Hs01_00016319 predicted 1639
6 SASI_Hs01_00016320 predicted 895
7 SASI_Hs01_00016321 predicted 796
8 SASI_Hs01_00016322 predicted 744
9 SASI_Hs01_00016323 predicted 1669
10 SASI_Hs01_00016324 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108306 predicted 787
2 SASI_Rn01_00108307 predicted 1443
3 SASI_Rn02_00198121 predicted 822
4 SASI_Rn01_00108308 predicted 727
5 SASI_Rn01_00108309 predicted 1358
6 SASI_Rn01_00108310 predicted 804
7 SASI_Rn01_00108311 predicted 900
8 SASI_Rn01_00108312 predicted 474
9 SASI_Rn01_00108313 predicted 1346
10 SASI_Rn02_00198122 predicted 743
11 SASI_Rn01_00108314 predicted 1771
12 SASI_Rn01_00108315 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021330 predicted 1008
2 SASI_Mm01_00021331 predicted 1290
3 SASI_Mm01_00021332 predicted 915
4 SASI_Mm01_00021333 predicted 1472
5 SASI_Mm01_00021334 predicted 1191
6 SASI_Mm01_00021335 predicted 862
7 SASI_Mm01_00021336 predicted 1563
8 SASI_Mm01_00021337 predicted 1766
9 SASI_Mm01_00021338 predicted 2150
10 SASI_Mm02_00312385 predicted 768
11 SASI_Mm01_00021329 predicted 1235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007760
CRAT MISSION shRNA Bacterial Glycerol Stock
carnitine O-acetyltransferase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007760.1-2231s1c1
Sequence:CCGGCCAATGTATCATCCACTCCATCTCGAGATGGAGTGGATGATACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-557s1c1
Sequence:CCGGCGAGGGTGTATTGGATTTCAACTCGAGTTGAAATCCAATACACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1757s1c1
Sequence:CCGGCGCCATTGCTATGCACTTCAACTCGAGTTGAAGTGCATAGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-740s1c1
Sequence:CCGGCGTGGTGCATAACTACCAGTTCTCGAGAACTGGTAGTTATGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1442s1c1
Sequence:CCGGGCTGGCATACTACAGGATCTACTCGAGTAGATCCTGTAGTATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2726s21c1
Sequence:CCGGTAGCTAAGGGTTAAGTCTTTGCTCGAGCAAAGACTTAACCCTTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2682s21c1
Sequence:CCGGGCGGTGGGAGGATTATCTATCCTCGAGGATAGATAATCCTCCCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007760.3-1831s21c1
Sequence:CCGGACTCGCTGGCCTTTGTCAAAGCTCGAGCTTTGACAAAGGCCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007760
CRAT MISSION shRNA shRNA Plasmid DNA
carnitine O-acetyltransferase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007760.1-2231s1c1
Sequence:CCGGCCAATGTATCATCCACTCCATCTCGAGATGGAGTGGATGATACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-557s1c1
Sequence:CCGGCGAGGGTGTATTGGATTTCAACTCGAGTTGAAATCCAATACACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1757s1c1
Sequence:CCGGCGCCATTGCTATGCACTTCAACTCGAGTTGAAGTGCATAGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-740s1c1
Sequence:CCGGCGTGGTGCATAACTACCAGTTCTCGAGAACTGGTAGTTATGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1442s1c1
Sequence:CCGGGCTGGCATACTACAGGATCTACTCGAGTAGATCCTGTAGTATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2726s21c1
Sequence:CCGGTAGCTAAGGGTTAAGTCTTTGCTCGAGCAAAGACTTAACCCTTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2682s21c1
Sequence:CCGGGCGGTGGGAGGATTATCTATCCTCGAGGATAGATAATCCTCCCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007760.3-1831s21c1
Sequence:CCGGACTCGCTGGCCTTTGTCAAAGCTCGAGCTTTGACAAAGGCCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007760
CRAT MISSION shRNA Lentiviral Transduction Particles
carnitine O-acetyltransferase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007760.1-2231s1c1
Sequence:CCGGCCAATGTATCATCCACTCCATCTCGAGATGGAGTGGATGATACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-557s1c1
Sequence:CCGGCGAGGGTGTATTGGATTTCAACTCGAGTTGAAATCCAATACACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1757s1c1
Sequence:CCGGCGCCATTGCTATGCACTTCAACTCGAGTTGAAGTGCATAGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-740s1c1
Sequence:CCGGCGTGGTGCATAACTACCAGTTCTCGAGAACTGGTAGTTATGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007760.1-1442s1c1
Sequence:CCGGGCTGGCATACTACAGGATCTACTCGAGTAGATCCTGTAGTATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2726s21c1
Sequence:CCGGTAGCTAAGGGTTAAGTCTTTGCTCGAGCAAAGACTTAACCCTTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007760.3-2682s21c1
Sequence:CCGGGCGGTGGGAGGATTATCTATCCTCGAGGATAGATAATCCTCCCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007760.3-1831s21c1
Sequence:CCGGACTCGCTGGCCTTTGTCAAAGCTCGAGCTTTGACAAAGGCCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000755
VALIDATED
CRAT MISSION shRNA Bacterial Glycerol Stock
carnitine O-acetyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_000755.2-1367s1c1
Sequence:CCGGGTCATCGAGTACACGAAGAAACTCGAGTTTCTTCGTGTACTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1075s1c1
Sequence:CCGGCAAGGCATACAACACCCTCATCTCGAGATGAGGGTGTTGTATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1969s1c1
Sequence:CCGGCAAGACAGACTGTGTCATGTTCTCGAGAACATGACACAGTCTGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-907s1c1
Sequence:CCGGCGTGGTACACAACTACCAGTTCTCGAGAACTGGTAGTTGTGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1525s1c1
Sequence:CCGGCGTGATGGTGTTCCACCATTTCTCGAGAAATGGTGGAACACCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000755.3-2279s21c1
Sequence:CCGGCAAATCTACTGAGCCACGGACCTCGAGGTCCGTGGCTCAGTAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1446s21c1
Sequence:CCGGGATCAAGAGCGACATCGAGAACTCGAGTTCTCGATGTCGCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-708s21c1
Sequence:CCGGCATTGAGGGTGTGTTGGATTTCTCGAGAAATCCAACACACCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1138s21c1
Sequence:CCGGGTGTGCCTAGATGCAACCATGCTCGAGCATGGTTGCATCTAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000755
VALIDATED
CRAT MISSION shRNA shRNA Plasmid DNA
carnitine O-acetyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_000755.2-1367s1c1
Sequence:CCGGGTCATCGAGTACACGAAGAAACTCGAGTTTCTTCGTGTACTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1075s1c1
Sequence:CCGGCAAGGCATACAACACCCTCATCTCGAGATGAGGGTGTTGTATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1969s1c1
Sequence:CCGGCAAGACAGACTGTGTCATGTTCTCGAGAACATGACACAGTCTGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-907s1c1
Sequence:CCGGCGTGGTACACAACTACCAGTTCTCGAGAACTGGTAGTTGTGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1525s1c1
Sequence:CCGGCGTGATGGTGTTCCACCATTTCTCGAGAAATGGTGGAACACCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000755.3-2279s21c1
Sequence:CCGGCAAATCTACTGAGCCACGGACCTCGAGGTCCGTGGCTCAGTAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1446s21c1
Sequence:CCGGGATCAAGAGCGACATCGAGAACTCGAGTTCTCGATGTCGCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-708s21c1
Sequence:CCGGCATTGAGGGTGTGTTGGATTTCTCGAGAAATCCAACACACCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1138s21c1
Sequence:CCGGGTGTGCCTAGATGCAACCATGCTCGAGCATGGTTGCATCTAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000755
VALIDATED
CRAT MISSION shRNA Lentiviral Transduction Particles
carnitine O-acetyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_000755.2-1367s1c1
Sequence:CCGGGTCATCGAGTACACGAAGAAACTCGAGTTTCTTCGTGTACTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1075s1c1
Sequence:CCGGCAAGGCATACAACACCCTCATCTCGAGATGAGGGTGTTGTATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1969s1c1
Sequence:CCGGCAAGACAGACTGTGTCATGTTCTCGAGAACATGACACAGTCTGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-907s1c1
Sequence:CCGGCGTGGTACACAACTACCAGTTCTCGAGAACTGGTAGTTGTGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000755.2-1525s1c1
Sequence:CCGGCGTGATGGTGTTCCACCATTTCTCGAGAAATGGTGGAACACCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000755.3-2279s21c1
Sequence:CCGGCAAATCTACTGAGCCACGGACCTCGAGGTCCGTGGCTCAGTAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1446s21c1
Sequence:CCGGGATCAAGAGCGACATCGAGAACTCGAGTTCTCGATGTCGCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-708s21c1
Sequence:CCGGCATTGAGGGTGTGTTGGATTTCTCGAGAAATCCAACACACCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000755.3-1138s21c1
Sequence:CCGGGTGTGCCTAGATGCAACCATGCTCGAGCATGGTTGCATCTAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks