EMAIL THIS PAGE TO A FRIEND

CRB1

crumbs homolog 1 (Drosophila)

221 Gene Product Result for
Synonyms: LCA8 RP12
Gene ID:
Human(23418) Summary: This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
Mouse(170788) crumbs homolog 1 (Drosophila)
Rat(304825) crumbs homolog 1 (Drosophila)
Zebrafish(560942) crumbs homolog 1 (Drosophila)
cow(520406) crumbs homolog 1 (Drosophila)
Horse(100061068) crumbs homolog 1 (Drosophila)
domestic cat(101092328) crumbs homolog 1 (Drosophila)
chicken(424352) crumbs homolog 1 (Drosophila)
dog(490260) crumbs homolog 1 (Drosophila)
sheep(101106957) crumbs homolog 1 (Drosophila)
Domestic Rabbit(100339170) crumbs homolog 1 (Drosophila)
naked mole-rat(101713890) crumbs homolog 1 (Drosophila)
domestic guinea pig(100732499) crumbs homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012076 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066171 MISSION® esiRNA esiRNA human CRB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201253 Rosetta Predictions human pricing
NM_001107182 Rosetta Predictions rat pricing
NM_133239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191366 predicted 2740
2 SASI_Hs02_00372901 predicted 1760
3 SASI_Hs01_00191367 predicted 286
4 SASI_Hs01_00191368 predicted 1830
5 SASI_Hs02_00372902 predicted 2680
6 SASI_Hs02_00372903 predicted 2751
7 SASI_Hs02_00372904 predicted 2500
8 SASI_Hs01_00191369 predicted 1255
9 SASI_Hs02_00372905 predicted 1678
10 SASI_Hs01_00191370 predicted 3235
11 SASI_Hs01_00191371 predicted 3988
12 SASI_Hs01_00191372 predicted 4341
13 SASI_Hs01_00191373 predicted 574
14 SASI_Hs01_00191374 predicted 2410
15 SASI_Hs01_00191375 predicted 2644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226315 predicted 727
2 SASI_Rn02_00226316 predicted 3434
3 SASI_Rn02_00226317 predicted 1772
4 SASI_Rn02_00226318 predicted 2239
5 SASI_Rn02_00226319 predicted 1333
6 SASI_Rn02_00226320 predicted 3040
7 SASI_Rn02_00226321 predicted 2979
8 SASI_Rn02_00226322 predicted 2489
9 SASI_Rn02_00226323 predicted 211
10 SASI_Rn02_00226324 predicted 3066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191752 predicted 1738
2 SASI_Mm01_00191753 predicted 3268
3 SASI_Mm01_00191754 predicted 2286
4 SASI_Mm02_00338494 predicted 326
5 SASI_Mm01_00191755 predicted 2330
6 SASI_Mm02_00338495 predicted 3396
7 SASI_Mm01_00191756 predicted 1099
8 SASI_Mm01_00191757 predicted 2220
9 SASI_Mm01_00191760 predicted 3175
10 SASI_Mm01_00191761 predicted 2618
11 SASI_Mm01_00191758 predicted 1308
12 SASI_Mm01_00191759 predicted 1721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133239
CRB1 MISSION shRNA Bacterial Glycerol Stock
crumbs homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2251s21c1
Sequence:CCGGTGAATGTGACAGGCCCTATACCTCGAGGTATAGGGCCTGTCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133239.2-4505s21c1
Sequence:CCGGTGGAGTCACTGAGTAGTTATGCTCGAGCATAACTACTCAGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-1115s21c1
Sequence:CCGGGATACTGTTGACAGCTATATTCTCGAGAATATAGCTGTCAACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-3461s21c1
Sequence:CCGGATAGAGATTGGAGGCATATATCTCGAGATATATGCCTCCAATCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2531s21c1
Sequence:CCGGGATGGAAATGTTCACTTAATACTCGAGTATTAAGTGAACATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2466s1c1
Sequence:CCGGCCCAAGTTCATGGTAAACTTTCTCGAGAAAGTTTACCATGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-1472s1c1
Sequence:CCGGCCAGTGTCTGAACAATGGAAACTCGAGTTTCCATTGTTCAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2302s1c1
Sequence:CCGGCGGCCTTTAGTGTTAATGATACTCGAGTATCATTAACACTAAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-3133s1c1
Sequence:CCGGGCATTCAAGATGCCAGATTATCTCGAGATAATCTGGCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133239
CRB1 MISSION shRNA shRNA Plasmid DNA
crumbs homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2251s21c1
Sequence:CCGGTGAATGTGACAGGCCCTATACCTCGAGGTATAGGGCCTGTCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133239.2-4505s21c1
Sequence:CCGGTGGAGTCACTGAGTAGTTATGCTCGAGCATAACTACTCAGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-1115s21c1
Sequence:CCGGGATACTGTTGACAGCTATATTCTCGAGAATATAGCTGTCAACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-3461s21c1
Sequence:CCGGATAGAGATTGGAGGCATATATCTCGAGATATATGCCTCCAATCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2531s21c1
Sequence:CCGGGATGGAAATGTTCACTTAATACTCGAGTATTAAGTGAACATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2466s1c1
Sequence:CCGGCCCAAGTTCATGGTAAACTTTCTCGAGAAAGTTTACCATGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-1472s1c1
Sequence:CCGGCCAGTGTCTGAACAATGGAAACTCGAGTTTCCATTGTTCAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2302s1c1
Sequence:CCGGCGGCCTTTAGTGTTAATGATACTCGAGTATCATTAACACTAAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-3133s1c1
Sequence:CCGGGCATTCAAGATGCCAGATTATCTCGAGATAATCTGGCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133239
CRB1 MISSION shRNA Lentiviral Transduction Particles
crumbs homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2251s21c1
Sequence:CCGGTGAATGTGACAGGCCCTATACCTCGAGGTATAGGGCCTGTCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133239.2-4505s21c1
Sequence:CCGGTGGAGTCACTGAGTAGTTATGCTCGAGCATAACTACTCAGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-1115s21c1
Sequence:CCGGGATACTGTTGACAGCTATATTCTCGAGAATATAGCTGTCAACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-3461s21c1
Sequence:CCGGATAGAGATTGGAGGCATATATCTCGAGATATATGCCTCCAATCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133239.2-2531s21c1
Sequence:CCGGGATGGAAATGTTCACTTAATACTCGAGTATTAAGTGAACATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2466s1c1
Sequence:CCGGCCCAAGTTCATGGTAAACTTTCTCGAGAAAGTTTACCATGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-1472s1c1
Sequence:CCGGCCAGTGTCTGAACAATGGAAACTCGAGTTTCCATTGTTCAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-2302s1c1
Sequence:CCGGCGGCCTTTAGTGTTAATGATACTCGAGTATCATTAACACTAAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133239.1-3133s1c1
Sequence:CCGGGCATTCAAGATGCCAGATTATCTCGAGATAATCTGGCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012076
CRB1 MISSION shRNA Bacterial Glycerol Stock
crumbs homolog 1 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-774s1c1
Sequence:CCGGCCACAATTATTCTGGTGTAAACTCGAGTTTACACCAGAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-1403s1c1
Sequence:CCGGGCCCATTTGATAACCTTTCTACTCGAGTAGAAAGGTTATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-2011s1c1
Sequence:CCGGGCTCTGCTTAACTTCTATAATCTCGAGATTATAGAAGTTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-556s1c1
Sequence:CCGGGCTGGAAGATTCTGTGAGATACTCGAGTATCTCACAGAATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-4216s1c1
Sequence:CCGGCGTATGAATGACGAGCCAGTTCTCGAGAACTGGCTCGTCATTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012076
CRB1 MISSION shRNA shRNA Plasmid DNA
crumbs homolog 1 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-774s1c1
Sequence:CCGGCCACAATTATTCTGGTGTAAACTCGAGTTTACACCAGAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-1403s1c1
Sequence:CCGGGCCCATTTGATAACCTTTCTACTCGAGTAGAAAGGTTATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-2011s1c1
Sequence:CCGGGCTCTGCTTAACTTCTATAATCTCGAGATTATAGAAGTTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-556s1c1
Sequence:CCGGGCTGGAAGATTCTGTGAGATACTCGAGTATCTCACAGAATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-4216s1c1
Sequence:CCGGCGTATGAATGACGAGCCAGTTCTCGAGAACTGGCTCGTCATTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012076
CRB1 MISSION shRNA Lentiviral Transduction Particles
crumbs homolog 1 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-774s1c1
Sequence:CCGGCCACAATTATTCTGGTGTAAACTCGAGTTTACACCAGAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-1403s1c1
Sequence:CCGGGCCCATTTGATAACCTTTCTACTCGAGTAGAAAGGTTATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-2011s1c1
Sequence:CCGGGCTCTGCTTAACTTCTATAATCTCGAGATTATAGAAGTTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-556s1c1
Sequence:CCGGGCTGGAAGATTCTGTGAGATACTCGAGTATCTCACAGAATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012076.2-4216s1c1
Sequence:CCGGCGTATGAATGACGAGCCAGTTCTCGAGAACTGGCTCGTCATTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks