EMAIL THIS PAGE TO A FRIEND

CRB2

crumbs homolog 2 (Drosophila)

57 Gene Product Result for
Gene ID:
Mouse(241324) crumbs homolog 2 (Drosophila)
Rat(366031) crumbs homolog 2 (Drosophila)
domestic guinea pig(100730462) crumbs homolog 2 (Drosophila)
naked mole-rat(101721478) crumbs homolog 2 (Drosophila)
sheep(101113926) crumbs homolog 2 (Drosophila)
chicken(417104) crumbs homolog 2 (Drosophila)
dog(491341) crumbs homolog 2 (Drosophila)
cow(786516) crumbs homolog 2 (Drosophila)
domestic cat(101088123) crumbs homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173689 Rosetta Predictions human pricing
XM_345347 Rosetta Predictions rat pricing
XR_007788 Rosetta Predictions rat pricing
XM_140952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138254 predicted 1054
2 SASI_Hs02_00368632 predicted 1102
3 SASI_Hs01_00138256 predicted 1859
4 SASI_Hs01_00138257 predicted 1209
5 SASI_Hs01_00138258 predicted 2170
6 SASI_Hs01_00138259 predicted 1498
7 SASI_Hs01_00138260 predicted 2250
8 SASI_Hs01_00138261 predicted 1960
9 SASI_Hs01_00138262 predicted 455
10 SASI_Hs01_00138263 predicted 264
11 SASI_Hs01_00138255 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398257 predicted 2068
2 SASI_Rn02_00398258 predicted 2059
3 SASI_Rn02_00398259 predicted 2461
4 SASI_Rn02_00398260 predicted 2353
5 SASI_Rn02_00398261 predicted 1892
6 SASI_Rn02_00398262 predicted 2350
7 SASI_Rn02_00398263 predicted 1538
8 SASI_Rn02_00398264 predicted 1250
9 SASI_Rn02_00398265 predicted 953
10 SASI_Rn02_00398266 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160101 predicted 2103
2 SASI_Rn01_00160102 predicted 2099
3 SASI_Rn01_00160103 predicted 2503
4 SASI_Rn01_00160105 predicted 2398
5 SASI_Rn01_00160106 predicted 1934
6 SASI_Rn02_00415485 predicted 2390
7 SASI_Rn01_00160107 predicted 1569
8 SASI_Rn02_00415486 predicted 1091
9 SASI_Rn01_00160109 predicted 1284
10 SASI_Rn01_00160110 predicted 996
11 SASI_Rn01_00160104 predicted 755
12 SASI_Rn01_00160108 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424992 predicted 629
2 SASI_Mm02_00424993 predicted 2315
3 SASI_Mm02_00424994 predicted 2372
4 SASI_Mm02_00424995 predicted 3777
5 SASI_Mm02_00424996 predicted 2666
6 SASI_Mm02_00424997 predicted 3814
7 SASI_Mm02_00424998 predicted 1394
8 SASI_Mm02_00424999 predicted 1357
9 SASI_Mm02_00425000 predicted 2665
10 SASI_Mm02_00425001 predicted 3794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173689
CRB2 MISSION shRNA Bacterial Glycerol Stock
crumbs homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-2528s1c1
Sequence:CCGGCCTGTTTCAATGGTGGGACTTCTCGAGAAGTCCCACCATTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1510s1c1
Sequence:CCGGACTCGCAATGACACCAAGGAACTCGAGTTCCTTGGTGTCATTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1943s1c1
Sequence:CCGGGTGTGGATCTGTGGACTCATTCTCGAGAATGAGTCCACAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-3298s1c1
Sequence:CCGGCGTGACCTCTTCGACGCCTTTCTCGAGAAAGGCGTCGAAGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-2168s21c1
Sequence:CCGGCGCAGCTGGCCTAACAGTATTCTCGAGAATACTGTTAGGCCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-1316s21c1
Sequence:CCGGTGCCACCTGCATCCCTATCTTCTCGAGAAGATAGGGATGCAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-3673s21c1
Sequence:CCGGTGTCTGAATGTATCTGCAATGCTCGAGCATTGCAGATACATTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173689.5-4330s21c1
Sequence:CCGGAGGGCGTGTCTGCCGTGTTTACTCGAGTAAACACGGCAGACACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173689
CRB2 MISSION shRNA shRNA Plasmid DNA
crumbs homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-2528s1c1
Sequence:CCGGCCTGTTTCAATGGTGGGACTTCTCGAGAAGTCCCACCATTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1510s1c1
Sequence:CCGGACTCGCAATGACACCAAGGAACTCGAGTTCCTTGGTGTCATTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1943s1c1
Sequence:CCGGGTGTGGATCTGTGGACTCATTCTCGAGAATGAGTCCACAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-3298s1c1
Sequence:CCGGCGTGACCTCTTCGACGCCTTTCTCGAGAAAGGCGTCGAAGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-2168s21c1
Sequence:CCGGCGCAGCTGGCCTAACAGTATTCTCGAGAATACTGTTAGGCCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-1316s21c1
Sequence:CCGGTGCCACCTGCATCCCTATCTTCTCGAGAAGATAGGGATGCAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-3673s21c1
Sequence:CCGGTGTCTGAATGTATCTGCAATGCTCGAGCATTGCAGATACATTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173689.5-4330s21c1
Sequence:CCGGAGGGCGTGTCTGCCGTGTTTACTCGAGTAAACACGGCAGACACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173689
CRB2 MISSION shRNA Lentiviral Transduction Particles
crumbs homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-2528s1c1
Sequence:CCGGCCTGTTTCAATGGTGGGACTTCTCGAGAAGTCCCACCATTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1510s1c1
Sequence:CCGGACTCGCAATGACACCAAGGAACTCGAGTTCCTTGGTGTCATTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-1943s1c1
Sequence:CCGGGTGTGGATCTGTGGACTCATTCTCGAGAATGAGTCCACAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173689.3-3298s1c1
Sequence:CCGGCGTGACCTCTTCGACGCCTTTCTCGAGAAAGGCGTCGAAGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-2168s21c1
Sequence:CCGGCGCAGCTGGCCTAACAGTATTCTCGAGAATACTGTTAGGCCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-1316s21c1
Sequence:CCGGTGCCACCTGCATCCCTATCTTCTCGAGAAGATAGGGATGCAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173689.5-3673s21c1
Sequence:CCGGTGTCTGAATGTATCTGCAATGCTCGAGCATTGCAGATACATTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173689.5-4330s21c1
Sequence:CCGGAGGGCGTGTCTGCCGTGTTTACTCGAGTAAACACGGCAGACACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks