EMAIL THIS PAGE TO A FRIEND

CRBN

cereblon

66 Gene Product Result for
Synonyms: MRT2 MRT2A
Gene ID:
Human(51185) Summary: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(58799) cereblon
Rat(297498) cereblon
dog(476551) cereblon
cow(511585) cereblon
Horse(100052958) cereblon
chicken(416104) cereblon
sheep(101111322) cereblon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016302 Rosetta Predictions human pricing
NM_001015003 Rosetta Predictions rat pricing
NM_021449 Rosetta Predictions mouse pricing
NM_175357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238485 predicted 329
2 SASI_Hs01_00238486 predicted 556
3 SASI_Hs02_00349227 predicted 1104
4 SASI_Hs01_00238487 predicted 614
5 SASI_Hs01_00238488 predicted 415
6 SASI_Hs02_00349228 predicted 1416
7 SASI_Hs01_00238489 predicted 1429
8 SASI_Hs01_00238491 predicted 604
9 SASI_Hs01_00238492 predicted 593
10 SASI_Hs01_00238493 predicted 1099
11 SASI_Hs01_00238490 predicted 1372
12 SASI_Hs01_00238494 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114289 predicted 1337
2 SASI_Rn01_00114290 predicted 767
3 SASI_Rn01_00114292 predicted 624
4 SASI_Rn01_00114293 predicted 1397
5 SASI_Rn01_00114294 predicted 884
6 SASI_Rn01_00114295 predicted 600
7 SASI_Rn01_00114296 predicted 289
8 SASI_Rn01_00114297 predicted 858
9 SASI_Rn01_00114298 predicted 954
10 SASI_Rn02_00201910 predicted 710
11 SASI_Rn01_00114291 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160378 predicted 764
2 SASI_Mm01_00160379 predicted 1344
3 SASI_Mm01_00160380 predicted 625
4 SASI_Mm02_00326098 predicted 585
5 SASI_Mm01_00160383 predicted 467
6 SASI_Mm01_00160384 predicted 1193
7 SASI_Mm02_00326099 predicted 352
8 SASI_Mm01_00160385 predicted 681
9 SASI_Mm01_00160386 predicted 473
10 SASI_Mm01_00160387 predicted 868
11 SASI_Mm01_00160381 predicted 1377
12 SASI_Mm01_00160382 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050719 predicted 769
2 SASI_Mm01_00050720 predicted 1343
3 SASI_Mm01_00050721 predicted 629
4 SASI_Mm02_00346155 predicted 584
5 SASI_Mm01_00050724 predicted 475
6 SASI_Mm01_00050725 predicted 1190
7 SASI_Mm02_00346156 predicted 348
8 SASI_Mm01_00050726 predicted 679
9 SASI_Mm01_00050727 predicted 479
10 SASI_Mm01_00050728 predicted 867
11 SASI_Mm01_00050722 predicted 1381
12 SASI_Mm01_00050723 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016302
CRBN MISSION shRNA Bacterial Glycerol Stock
cereblon
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1112s1c1
Sequence:CCGGGCTTGCAACTTGAATCTGATACTCGAGTATCAGATTCAAGTTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-125s1c1
Sequence:CCGGCAGGATAGTAAAGAAGCCAAACTCGAGTTTGGCTTCTTTACTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-1058s1c1
Sequence:CCGGGCAGCTTATGTGAATCCTCATCTCGAGATGAGGATTCACATAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1267s1c1
Sequence:CCGGCTTAACGCGATCTGCTCTGTTCTCGAGAACAGAGCAGATCGCGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-743s1c1
Sequence:CCGGCGCTGGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016302.2-1561s1c1
Sequence:CCGGCCAGAAACATCTACTTGGGTACTCGAGTACCCAAGTAGATGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-621s1c1
Sequence:CCGGCCCTCAATAAGTGCCAGATATCTCGAGATATCTGGCACTTATTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-872s1c1
Sequence:CCGGGCTGCTTGTCTTCCTATTGATCTCGAGATCAATAGGAAGACAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016302.2-1938s1c1
Sequence:CCGGGCCCACGAATAGTTGTCATTTCTCGAGAAATGACAACTATTCGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016302
CRBN MISSION shRNA shRNA Plasmid DNA
cereblon
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1112s1c1
Sequence:CCGGGCTTGCAACTTGAATCTGATACTCGAGTATCAGATTCAAGTTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-125s1c1
Sequence:CCGGCAGGATAGTAAAGAAGCCAAACTCGAGTTTGGCTTCTTTACTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-1058s1c1
Sequence:CCGGGCAGCTTATGTGAATCCTCATCTCGAGATGAGGATTCACATAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1267s1c1
Sequence:CCGGCTTAACGCGATCTGCTCTGTTCTCGAGAACAGAGCAGATCGCGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-743s1c1
Sequence:CCGGCGCTGGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016302.2-1561s1c1
Sequence:CCGGCCAGAAACATCTACTTGGGTACTCGAGTACCCAAGTAGATGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-621s1c1
Sequence:CCGGCCCTCAATAAGTGCCAGATATCTCGAGATATCTGGCACTTATTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-872s1c1
Sequence:CCGGGCTGCTTGTCTTCCTATTGATCTCGAGATCAATAGGAAGACAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016302.2-1938s1c1
Sequence:CCGGGCCCACGAATAGTTGTCATTTCTCGAGAAATGACAACTATTCGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016302
CRBN MISSION shRNA Lentiviral Transduction Particles
cereblon
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1112s1c1
Sequence:CCGGGCTTGCAACTTGAATCTGATACTCGAGTATCAGATTCAAGTTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-125s1c1
Sequence:CCGGCAGGATAGTAAAGAAGCCAAACTCGAGTTTGGCTTCTTTACTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-1058s1c1
Sequence:CCGGGCAGCTTATGTGAATCCTCATCTCGAGATGAGGATTCACATAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016302.2-1267s1c1
Sequence:CCGGCTTAACGCGATCTGCTCTGTTCTCGAGAACAGAGCAGATCGCGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-743s1c1
Sequence:CCGGCGCTGGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016302.2-1561s1c1
Sequence:CCGGCCAGAAACATCTACTTGGGTACTCGAGTACCCAAGTAGATGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-621s1c1
Sequence:CCGGCCCTCAATAAGTGCCAGATATCTCGAGATATCTGGCACTTATTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016302.2-872s1c1
Sequence:CCGGGCTGCTTGTCTTCCTATTGATCTCGAGATCAATAGGAAGACAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016302.2-1938s1c1
Sequence:CCGGGCCCACGAATAGTTGTCATTTCTCGAGAAATGACAACTATTCGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021449
VALIDATED
CRBN MISSION shRNA Bacterial Glycerol Stock
cereblon
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-1422s1c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-582s1c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-956s1c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-715s1c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021449.1-1175s1c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-747s21c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-1207s21c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-988s21c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-614s21c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021449.2-1454s21c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021449
VALIDATED
CRBN MISSION shRNA shRNA Plasmid DNA
cereblon
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-1422s1c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-582s1c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-956s1c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-715s1c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021449.1-1175s1c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-747s21c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-1207s21c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-988s21c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-614s21c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021449.2-1454s21c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021449
VALIDATED
CRBN MISSION shRNA Lentiviral Transduction Particles
cereblon
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-1422s1c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-582s1c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-956s1c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021449.1-715s1c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021449.1-1175s1c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-747s21c1
Sequence:CCGGCGCTGGCTGTATTCATTATATCTCGAGATATAATGAATACAGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-1207s21c1
Sequence:CCGGCAAGCCATATTGGATGGAAATCTCGAGATTTCCATCCAATATGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-988s21c1
Sequence:CCGGGCTGTAAACAATGTCAAGAAACTCGAGTTTCTTGACATTGTTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021449.2-614s21c1
Sequence:CCGGGCAGTTAGAATCACTCAATAACTCGAGTTATTGAGTGATTCTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021449.2-1454s21c1
Sequence:CCGGCCTACCAAGTTCAAGAGCATACTCGAGTATGCTCTTGAACTTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)