EMAIL THIS PAGE TO A FRIEND

CRCP

CGRP receptor component

Synonyms: CGRP-RCP CGRPRCP RCP RCP9
Gene ID:
Human(27297) Summary: This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(12909) calcitonin gene-related peptide-receptor component protein
Rat(114205) CGRP receptor component
Zebrafish(751656) calcitonin gene-related peptide-receptor component protein
cow(507533) CGRP receptor component
domestic cat(101084503) CGRP receptor component
dog(479705) CGRP receptor component
chicken(396022) CGRP receptor component
naked mole-rat(101710741) CGRP receptor component
domestic guinea pig(100135504) calcitonin gene-related peptide-receptor component protein
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007216 Anti-CRCP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014478 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113671 MISSION® esiRNA esiRNA human AC068533.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040647 Rosetta Predictions human pricing
NM_001040648 Rosetta Predictions human pricing
NM_014478 Rosetta Predictions human pricing
NM_053670 Rosetta Predictions rat pricing
NM_007761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137211 predicted 825
2 SASI_Hs01_00137212 predicted 603
3 SASI_Hs01_00137213 predicted 941
4 SASI_Hs01_00137214 predicted 553
5 SASI_Hs01_00137215 predicted 548
6 SASI_Hs01_00137216 predicted 605
7 SASI_Hs01_00137217 predicted 534
8 SASI_Hs01_00137218 predicted 530
9 SASI_Hs01_00137219 predicted 940
10 SASI_Hs01_00137220 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103714 predicted 695
2 SASI_Hs01_00103715 predicted 468
3 SASI_Hs01_00103716 predicted 812
4 SASI_Hs01_00103717 predicted 420
5 SASI_Hs01_00103718 predicted 416
6 SASI_Hs01_00103719 predicted 478
7 SASI_Hs01_00103720 predicted 405
8 SASI_Hs01_00103721 predicted 397
9 SASI_Hs01_00103722 predicted 811
10 SASI_Hs02_00309024 predicted 815
11 SASI_Hs01_00103723 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085463 predicted 930
2 SASI_Hs01_00085464 predicted 696
3 SASI_Hs01_00085465 predicted 1040
4 SASI_Hs01_00085466 predicted 655
5 SASI_Hs01_00085467 predicted 648
6 SASI_Hs01_00085468 predicted 708
7 SASI_Hs01_00085469 predicted 631
8 SASI_Hs01_00085470 predicted 629
9 SASI_Hs01_00085471 predicted 1042
10 SASI_Hs01_00085472 predicted 189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055199 predicted 206
2 SASI_Rn02_00266398 predicted 197
3 SASI_Rn02_00266399 predicted 267
4 SASI_Rn02_00266400 predicted 200
5 SASI_Rn01_00055200 predicted 293
6 SASI_Rn01_00055202 predicted 283
7 SASI_Rn02_00266401 predicted 307
8 SASI_Rn02_00266402 predicted 330
9 SASI_Rn01_00055204 predicted 265
10 SASI_Rn01_00055207 predicted 279
11 SASI_Rn01_00055198 predicted 219
12 SASI_Rn01_00055201 predicted 254
13 SASI_Rn01_00055203 predicted 290
14 SASI_Rn01_00055205 predicted 245
15 SASI_Rn01_00055206 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156877 predicted 264
2 SASI_Mm01_00156878 predicted 272
3 SASI_Mm01_00156879 predicted 965
4 SASI_Mm01_00156880 predicted 400
5 SASI_Mm01_00156881 predicted 952
6 SASI_Mm01_00156882 predicted 625
7 SASI_Mm01_00156883 predicted 815
8 SASI_Mm01_00156884 predicted 941
9 SASI_Mm01_00156885 predicted 225
10 SASI_Mm01_00156886 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007761
VALIDATED
CRCP MISSION shRNA Bacterial Glycerol Stock
CGRP receptor component
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-499s21c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-145s21c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-476s21c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007761.2-1260s21c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-1260s1c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-476s1c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-499s1c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-145s1c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007761
VALIDATED
CRCP MISSION shRNA shRNA Plasmid DNA
CGRP receptor component
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-499s21c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-145s21c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-476s21c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007761.2-1260s21c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-1260s1c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-476s1c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-499s1c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-145s1c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007761
VALIDATED
CRCP MISSION shRNA Lentiviral Transduction Particles
CGRP receptor component
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-499s21c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-145s21c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007761.2-476s21c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007761.2-1260s21c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-1260s1c1
Sequence:CCGGGCCCACATTGACCTTGAACTTCTCGAGAAGTTCAAGGTCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-476s1c1
Sequence:CCGGCCAGAGGATGAACAGAGCAAACTCGAGTTTGCTCTGTTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-499s1c1
Sequence:CCGGCACTAGCAATGACGTGGCTATCTCGAGATAGCCACGTCATTGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007761.1-145s1c1
Sequence:CCGGCCAGTTACTAACGGATCTCAACTCGAGTTGAGATCCGTTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014478
VALIDATED
CRCP MISSION shRNA Bacterial Glycerol Stock
CGRP receptor component
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014478.4-220s21c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-574s21c1
Sequence:CCGGCGAAGAGGACCCAGCATAGAACTCGAGTTCTATGCTGGGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014478.4-926s21c1
Sequence:CCGGTGGTGGGCCATGTCCTAATTACTCGAGTAATTAGGACATGGCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-277s21c1
Sequence:CCGGTATCACCTATGAAACGTTAAACTCGAGTTTAACGTTTCATAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-320s21c1
Sequence:CCGGAGGCACCAGAGTCCTGAAATTCTCGAGAATTTCAGGACTCTGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-136s1c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-259s1c1
Sequence:CCGGCAGAGAATTTCTCACAGCATTCTCGAGAATGCTGTGAGAAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-92s1c1
Sequence:CCGGCTCAGTAACTACGAGGTATTTCTCGAGAAATACCTCGTAGTTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-457s1c1
Sequence:CCGGGAAGAAGAATACAAACAGCAACTCGAGTTGCTGTTTGTATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-113s1c1
Sequence:CCGGCAGTTACTAACTGATCTGAAACTCGAGTTTCAGATCAGTTAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014478
VALIDATED
CRCP MISSION shRNA shRNA Plasmid DNA
CGRP receptor component
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014478.4-220s21c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-574s21c1
Sequence:CCGGCGAAGAGGACCCAGCATAGAACTCGAGTTCTATGCTGGGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014478.4-926s21c1
Sequence:CCGGTGGTGGGCCATGTCCTAATTACTCGAGTAATTAGGACATGGCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-277s21c1
Sequence:CCGGTATCACCTATGAAACGTTAAACTCGAGTTTAACGTTTCATAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-320s21c1
Sequence:CCGGAGGCACCAGAGTCCTGAAATTCTCGAGAATTTCAGGACTCTGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-136s1c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-259s1c1
Sequence:CCGGCAGAGAATTTCTCACAGCATTCTCGAGAATGCTGTGAGAAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-92s1c1
Sequence:CCGGCTCAGTAACTACGAGGTATTTCTCGAGAAATACCTCGTAGTTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-457s1c1
Sequence:CCGGGAAGAAGAATACAAACAGCAACTCGAGTTGCTGTTTGTATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-113s1c1
Sequence:CCGGCAGTTACTAACTGATCTGAAACTCGAGTTTCAGATCAGTTAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014478
VALIDATED
CRCP MISSION shRNA Lentiviral Transduction Particles
CGRP receptor component
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014478.4-220s21c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-574s21c1
Sequence:CCGGCGAAGAGGACCCAGCATAGAACTCGAGTTCTATGCTGGGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014478.4-926s21c1
Sequence:CCGGTGGTGGGCCATGTCCTAATTACTCGAGTAATTAGGACATGGCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-277s21c1
Sequence:CCGGTATCACCTATGAAACGTTAAACTCGAGTTTAACGTTTCATAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014478.4-320s21c1
Sequence:CCGGAGGCACCAGAGTCCTGAAATTCTCGAGAATTTCAGGACTCTGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-136s1c1
Sequence:CCGGGCAGCGTAAAGAAAGTGGAAACTCGAGTTTCCACTTTCTTTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-259s1c1
Sequence:CCGGCAGAGAATTTCTCACAGCATTCTCGAGAATGCTGTGAGAAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014478.3-92s1c1
Sequence:CCGGCTCAGTAACTACGAGGTATTTCTCGAGAAATACCTCGTAGTTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-457s1c1
Sequence:CCGGGAAGAAGAATACAAACAGCAACTCGAGTTGCTGTTTGTATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014478.3-113s1c1
Sequence:CCGGCAGTTACTAACTGATCTGAAACTCGAGTTTCAGATCAGTTAGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks