EMAIL THIS PAGE TO A FRIEND

CREB1

cAMP responsive element binding protein 1

242 Gene Product Result for
Synonyms: CREB
UniProtKB ID: P16220, P21934, Q6V963, Q9UMA7
Gene ID:
Human(1385) Summary: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(12912) cAMP responsive element binding protein 1
Rat(81646) cAMP responsive element binding protein 1
domestic guinea pig(100727326) cAMP responsive element binding protein 1
naked mole-rat(101712503) cAMP responsive element binding protein 1
chicken(395099) cAMP responsive element binding protein 1
cow(281713) cAMP responsive element binding protein 1
Horse(100066388) cAMP responsive element binding protein 1
domestic cat(101091299) cAMP responsive element binding protein 1
dog(607922) cAMP responsive element binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500441 Anti-CREB antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500442 Anti-CREB antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500443 Anti-CREB antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500444 Anti-CREB antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500445 Anti-CREB antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4300519 Anti-CREB1 (Ab-129) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4300333 Anti-CREB1 (Ab-133) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4300546 Anti-CREB1 (Ab-142) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry pricing
AV37464 Anti-CREB1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, rat, rabbit, bovine, canine, pig, horse
western blot pricing
AV01026 Anti-CREB1 (AB2) antibody produced in rabbit affinity isolated antibody rat, zebrafish, canine, pig, human, mouse, bovine
western blot pricing
AV31264 Anti-CREB1 antibody produced in rabbit IgG fraction of antiserum rat, human, bovine, canine, mouse
western blot pricing
HPA019150 Anti-CREB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103540 Anti-CREB1 antibody produced in rabbit affinity isolated antibody zebrafish, rabbit, guinea pig, sheep, rat, horse, canine, bovine, human, mouse, pig
western blot pricing
SAB4503908 Anti-phospho-CREB (pSer121) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
C9102 Anti-phospho-CREB (pSer133) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunoprecipitation, western blot pricing
SAB4504375 Anti-phospho-CREB (pSer133) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503757 Anti-phospho-CREB (pSer142) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504577 Anti-phospho-CREB (pThr100) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB1306301 ANTI-PHOSPHO-CREB(S133) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4300217 Anti-phospho-CREB1 (pSer129) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4300040 Anti-phospho-CREB1 (pSer133) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
C8977 Monoclonal Anti-CREB antibody produced in rabbit clone 48H2, purified immunoglobulin, buffered aqueous glycerol solution human, rat, mouse, monkey
ChIP, flow cytometry, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
WH0001385M1 Monoclonal Anti-CREB1 antibody produced in mouse clone 3F1-1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403692 Monoclonal Anti-CREB1, (N-terminal) antibody produced in mouse clone 5F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
PLA0205 Rabbit anti-CREB Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, rat, chicken, bovine, toad, turkey, guinea pig, human, mouse, rabbit, toad, sheep, dog
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABE553 Anti-CREB-1 Antibody 100 µg, Detect CREB using this rabbit polyclonal antibody, Anti-CREB-1 Antibody validated for use in western blotting & ICC. pricing
06-863 Anti-CREB Antibody 200 µg, Anti-CREB Antibody, Cat. No. 06-863, is a highly specific rabbit Polyclonal antibody, that targets CREB and has been tested in Chromatin Immunoprecipitation (ChIP), ChIP-seq, Electrophoretic Mobility Shift Assay (EMSA), Immunoprecipitation, and Western Blotting. pricing
AB3006 Anti-CREB Antibody 100 µL, Use Anti-CREB Antibody (Rabbit Polyclonal Antibody) validated in ELISA, EMSA, IP, WB to detect CREB also known as CREB-1, cAMP-response Element-binding Protein-1. pricing
MAB5432 Anti-CREB Antibody 100 µg, Anti-CREB Antibody is a Mouse Monoclonal Antibody for detection of CREB also known as cAMP-response Element Binding Protein & has been validated in ELISA & WB. pricing
MAB5432-C Anti-CREB Antibody, clone LB9, Ascites Free 100 μg, Anti-CREB Antibody, clone LB9, Ascites Free is an antibody against CREB for use in Western Blotting, Immunohistochemistry (Paraffin). pricing
04-767 Anti-CREB Antibody, clone NL904, rabbit monoclonal 100 µL, Detect CREB also known as cAMP-response Element Binding Protein with Anti-CREB Antibody, clone NL904 (Rabbit Monoclonal Antibody), that has been demonstrated to work in IP & WB. pricing
AB3442 Anti-CREB Antibody, pSer133 100 µL, Anti-CREB Antibody, pSer133 is a Rabbit Polyclonal Antibody for detection of CREB also known as CREB-1, cAMP-response Element-binding Protein-1 & has been validated in WB. pricing
06-519 Anti-phospho-CREB (Ser133) Antibody 100 µL, Use Anti-phospho-CREB (Ser133) Antibody (rabbit polyclonal antibody) is highly published and validated in EMSA, IHC,IHC(P), IP, WB to detect phospho-CREB (Ser133) also known as active transcription factor CREB, cAMP responsive element binding protein 1. pricing
06-519-AF488 Anti-phospho-CREB (Ser133) Antibody, Alexa Fluor® 488 conjugate 100 µL, Anti-phospho-CREB (Ser133) Antibody, Alexa Fluor® 488 conjugate is an antibody against phospho-CREB for use in Immunofluorescence. pricing
06-519-AF647 Anti-phospho-CREB (Ser133) Antibody, Alexa Fluor®647 conjugate 100 µL, Anti-phospho-CREB (Ser133) Antibody, Alexa Fluor®647 conjugate is an antibody against phospho-CREB for use in Immunofluorescence. pricing
05-667 Anti-phospho-CREB (Ser133) Antibody, clone 10E9 100 µg, Anti-phospho-CREB (Ser133) Antibody, clone 10E9 is a Mouse Monoclonal Antibody for detection of phospho-CREB (Ser133) also known as active transcription factor CREB & has been validated in WB, ELISA. pricing
17-600 ChIPAb+ CREB - ChIP Validated Antibody and Primer Set, rabbit monoclonal 25 assays, This ChIPAb+ CREB -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004379 Rosetta Predictions human pricing
NM_134442 Rosetta Predictions human pricing
NM_031017 Rosetta Predictions rat pricing
NM_134443 Rosetta Predictions rat pricing
NM_001037726 Rosetta Predictions mouse pricing
NM_009952 Rosetta Predictions mouse pricing
NM_133828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116985 predicted 1274
2 SASI_Hs02_00337466 predicted 1138
3 SASI_Hs01_00116986 predicted 1100
4 SASI_Hs01_00116987 predicted 982
5 SASI_Hs01_00116988 predicted 789
6 SASI_Hs01_00116989 predicted 699
7 SASI_Hs01_00116990 predicted 659
8 SASI_Hs01_00116991 predicted 894
9 SASI_Hs01_00116992 predicted 789
10 SASI_Hs01_00116993 predicted 842
11 SASI_Hs01_00116994 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107963 predicted 1320
2 SASI_Hs02_00363328 predicted 1174
3 SASI_Hs01_00107964 predicted 1148
4 SASI_Hs01_00107965 predicted 1024
5 SASI_Hs01_00107966 predicted 825
6 SASI_Hs01_00107967 predicted 739
7 SASI_Hs01_00107968 predicted 698
8 SASI_Hs01_00107969 predicted 928
9 SASI_Hs01_00107970 predicted 826
10 SASI_Hs01_00107971 predicted 889
11 SASI_Hs01_00107972 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042004 predicted 256
2 SASI_Rn01_00042005 predicted 595
3 SASI_Rn01_00042006 predicted 766
4 SASI_Rn01_00042007 predicted 787
5 SASI_Rn01_00042008 predicted 370
6 SASI_Rn01_00042010 predicted 611
7 SASI_Rn02_00264211 predicted 295
8 SASI_Rn01_00042011 predicted 744
9 SASI_Rn01_00042012 predicted 648
10 SASI_Rn01_00042013 predicted 289
11 SASI_Rn01_00042009 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042680 predicted 523
2 SASI_Rn02_00268029 predicted 692
3 SASI_Rn01_00042681 predicted 706
4 SASI_Rn01_00042682 predicted 287
5 SASI_Rn01_00042683 predicted 532
6 SASI_Rn01_00042684 predicted 661
7 SASI_Rn01_00042685 predicted 665
8 SASI_Rn01_00042686 predicted 599
9 SASI_Rn01_00042687 predicted 481
10 SASI_Rn01_00042688 predicted 522
11 SASI_Rn01_00042679 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289365 predicted 1058
2 SASI_Mm02_00289366 predicted 1024
3 SASI_Mm02_00289367 predicted 618
4 SASI_Mm02_00289368 predicted 706
5 SASI_Mm02_00289369 predicted 1079
6 SASI_Mm02_00289370 predicted 623
7 SASI_Mm02_00289371 predicted 738
8 SASI_Mm02_00289372 predicted 771
9 SASI_Mm02_00289373 predicted 708
10 SASI_Mm02_00289374 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090164 predicted 1218
2 SASI_Mm02_00317514 predicted 1186
3 SASI_Mm01_00090165 predicted 789
4 SASI_Mm01_00090166 predicted 872
5 SASI_Mm01_00090167 predicted 1236
6 SASI_Mm01_00090168 predicted 791
7 SASI_Mm01_00090169 predicted 900
8 SASI_Mm01_00090170 predicted 927
9 SASI_Mm01_00090172 predicted 871
10 SASI_Mm01_00090173 predicted 784
11 SASI_Mm01_00090171 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191782 predicted 1175
2 SASI_Mm02_00338846 predicted 1151
3 SASI_Mm01_00191783 predicted 740
4 SASI_Mm01_00191784 predicted 834
5 SASI_Mm01_00191785 predicted 1192
6 SASI_Mm01_00191786 predicted 749
7 SASI_Mm01_00191787 predicted 856
8 SASI_Mm01_00191788 predicted 888
9 SASI_Mm01_00191790 predicted 825
10 SASI_Mm01_00191791 predicted 746
11 SASI_Mm01_00191789 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004379
VALIDATED
CREB1 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-778s21c1
Sequence:CCGGCAATACAGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004379.3-1352s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-545s21c1
Sequence:CCGGGGAGTCAGTGGATAGTGTAACCTCGAGGTTACACTATCCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.2-882s21c1
Sequence:GTACCGGACGTACAAACATACCAGATTCCTCGAGGAATCTGGTATGTTTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-2002s21c1
Sequence:CCGGACCAATCCCTTGAGTTATATACTCGAGTATATAACTCAAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-905s21c1
Sequence:CCGGACAGCACCCACTAGCACTATTCTCGAGAATAGTGCTAGTGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-644s21c1
Sequence:CCGGACGGTGCCAACTCCAATTTACCTCGAGGTAAATTGGAGTTGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-284s21c1
Sequence:CCGGACATTAGCCCAGGTATCTATGCTCGAGCATAGATACCTGGGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-1004s1c1
Sequence:CCGGCGTCTAATGAAGAACAGGGAACTCGAGTTCCCTGTTCTTCATTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004379.2-2568s1c1
Sequence:CCGGGCTCGATAAATCTAACAGTTACTCGAGTAACTGTTAGATTTATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-751s1c1
Sequence:CCGGGCAAACATTAACCATGACCAACTCGAGTTGGTCATGGTTAATGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-480s1c1
Sequence:CCGGCAGTGGATAGTGTAACTGATTCTCGAGAATCAGTTACACTATCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004379
VALIDATED
CREB1 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-778s21c1
Sequence:CCGGCAATACAGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004379.3-1352s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-545s21c1
Sequence:CCGGGGAGTCAGTGGATAGTGTAACCTCGAGGTTACACTATCCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.2-882s21c1
Sequence:GTACCGGACGTACAAACATACCAGATTCCTCGAGGAATCTGGTATGTTTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-2002s21c1
Sequence:CCGGACCAATCCCTTGAGTTATATACTCGAGTATATAACTCAAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-905s21c1
Sequence:CCGGACAGCACCCACTAGCACTATTCTCGAGAATAGTGCTAGTGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-644s21c1
Sequence:CCGGACGGTGCCAACTCCAATTTACCTCGAGGTAAATTGGAGTTGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-284s21c1
Sequence:CCGGACATTAGCCCAGGTATCTATGCTCGAGCATAGATACCTGGGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-1004s1c1
Sequence:CCGGCGTCTAATGAAGAACAGGGAACTCGAGTTCCCTGTTCTTCATTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004379.2-2568s1c1
Sequence:CCGGGCTCGATAAATCTAACAGTTACTCGAGTAACTGTTAGATTTATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-751s1c1
Sequence:CCGGGCAAACATTAACCATGACCAACTCGAGTTGGTCATGGTTAATGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-480s1c1
Sequence:CCGGCAGTGGATAGTGTAACTGATTCTCGAGAATCAGTTACACTATCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004379
VALIDATED
CREB1 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-778s21c1
Sequence:CCGGCAATACAGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004379.3-1352s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.3-545s21c1
Sequence:CCGGGGAGTCAGTGGATAGTGTAACCTCGAGGTTACACTATCCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004379.2-882s21c1
Sequence:GTACCGGACGTACAAACATACCAGATTCCTCGAGGAATCTGGTATGTTTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-2002s21c1
Sequence:CCGGACCAATCCCTTGAGTTATATACTCGAGTATATAACTCAAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-905s21c1
Sequence:CCGGACAGCACCCACTAGCACTATTCTCGAGAATAGTGCTAGTGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-644s21c1
Sequence:CCGGACGGTGCCAACTCCAATTTACCTCGAGGTAAATTGGAGTTGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004379.2-284s21c1
Sequence:CCGGACATTAGCCCAGGTATCTATGCTCGAGCATAGATACCTGGGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-1004s1c1
Sequence:CCGGCGTCTAATGAAGAACAGGGAACTCGAGTTCCCTGTTCTTCATTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004379.2-2568s1c1
Sequence:CCGGGCTCGATAAATCTAACAGTTACTCGAGTAACTGTTAGATTTATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-751s1c1
Sequence:CCGGGCAAACATTAACCATGACCAACTCGAGTTGGTCATGGTTAATGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004379.2-480s1c1
Sequence:CCGGCAGTGGATAGTGTAACTGATTCTCGAGAATCAGTTACACTATCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133828
VALIDATED
CREB1 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-519s21c1
Sequence:CCGGGGAGTCTGTGGATAGTGTAACCTCGAGGTTACACTATCCACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-479s21c1
Sequence:CCGGCAGTTCAGATTTCAACTATTGCTCGAGCAATAGTTGAAATCTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-865s21c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-1324s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-350s21c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1257s1c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133828.1-693s1c1
Sequence:CCGGCTGGCTAACAATGGTACGGATCTCGAGATCCGTACCATTGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1004s1c1
Sequence:CCGGAGCAAGAGAATGTCGTAGAAACTCGAGTTTCTACGACATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-798s1c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-283s1c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133828
VALIDATED
CREB1 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-519s21c1
Sequence:CCGGGGAGTCTGTGGATAGTGTAACCTCGAGGTTACACTATCCACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-479s21c1
Sequence:CCGGCAGTTCAGATTTCAACTATTGCTCGAGCAATAGTTGAAATCTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-865s21c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-1324s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-350s21c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1257s1c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133828.1-693s1c1
Sequence:CCGGCTGGCTAACAATGGTACGGATCTCGAGATCCGTACCATTGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1004s1c1
Sequence:CCGGAGCAAGAGAATGTCGTAGAAACTCGAGTTTCTACGACATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-798s1c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-283s1c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133828
VALIDATED
CREB1 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-519s21c1
Sequence:CCGGGGAGTCTGTGGATAGTGTAACCTCGAGGTTACACTATCCACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-479s21c1
Sequence:CCGGCAGTTCAGATTTCAACTATTGCTCGAGCAATAGTTGAAATCTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-865s21c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133828.2-1324s21c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133828.2-350s21c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1257s1c1
Sequence:CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133828.1-693s1c1
Sequence:CCGGCTGGCTAACAATGGTACGGATCTCGAGATCCGTACCATTGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-1004s1c1
Sequence:CCGGAGCAAGAGAATGTCGTAGAAACTCGAGTTTCTACGACATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-798s1c1
Sequence:CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133828.1-283s1c1
Sequence:CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks