EMAIL THIS PAGE TO A FRIEND

CREB3

cAMP responsive element binding protein 3

54 Gene Product Result for
Synonyms: LUMAN LZIP
Gene ID:
Human(10488) Summary: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Mouse(12913) cAMP responsive element binding protein 3
Rat(298400) cAMP responsive element binding protein 3
chicken(427417) cAMP responsive element binding protein 3
dog(611934) cAMP responsive element binding protein 3
domestic cat(101093555) cAMP responsive element binding protein 3
cow(281715) cAMP responsive element binding protein 3
naked mole-rat(101718447) cAMP responsive element binding protein 3
domestic guinea pig(100731200) cAMP responsive element binding protein 3
sheep(101114243) cAMP responsive element binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006368 Rosetta Predictions human pricing
NM_001013092 Rosetta Predictions rat pricing
NM_013497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073863 predicted 1558
2 SASI_Hs01_00073864 predicted 756
3 SASI_Hs01_00073865 predicted 1546
4 SASI_Hs01_00073866 predicted 1132
5 SASI_Hs01_00073867 predicted 1094
6 SASI_Hs01_00073868 predicted 752
7 SASI_Hs01_00073869 predicted 882
8 SASI_Hs01_00073870 predicted 825
9 SASI_Hs01_00073871 predicted 1183
10 SASI_Hs01_00073872 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099873 predicted 328
2 SASI_Rn01_00099874 predicted 393
3 SASI_Rn01_00099875 predicted 614
4 SASI_Rn02_00200745 predicted 405
5 SASI_Rn01_00099877 predicted 698
6 SASI_Rn01_00099878 predicted 710
7 SASI_Rn01_00099879 predicted 705
8 SASI_Rn01_00099880 predicted 759
9 SASI_Rn01_00099881 predicted 413
10 SASI_Rn01_00099882 predicted 937
11 SASI_Rn01_00099876 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322138 predicted 379
2 SASI_Mm01_00024943 predicted 811
3 SASI_Mm01_00024944 predicted 851
4 SASI_Mm01_00024947 predicted 1098
5 SASI_Mm02_00322139 predicted 1303
6 SASI_Mm01_00024951 predicted 480
7 SASI_Mm02_00322140 predicted 575
8 SASI_Mm02_00322141 predicted 1199
9 SASI_Mm02_00322142 predicted 697
10 SASI_Mm02_00322143 predicted 255
11 SASI_Mm01_00024942 predicted 1008
12 SASI_Mm01_00024945 predicted 948
13 SASI_Mm01_00024946 predicted 773
14 SASI_Mm01_00024948 predicted 525
15 SASI_Mm01_00024949 predicted 611
16 SASI_Mm01_00024950 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006368
VALIDATED
CREB3 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006368.4-1688s1c1
Sequence:CCGGGCTCAAACACACCACACTTAACTCGAGTTAAGTGTGGTGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-1488s1c1
Sequence:CCGGGCAGGCAAATCTCACAAGGAACTCGAGTTCCTTGTGAGATTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-916s1c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-501s1c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-877s1c1
Sequence:CCGGCCTCTCACTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-882s21c1
Sequence:CCGGCACTAAGACAGAGGAACAAATCTCGAGATTTGTTCCTCTGTCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-1553s21c1
Sequence:CCGGACAGATACTCAGGCTAGATATCTCGAGATATCTAGCCTGAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006368.4-1686s21c1
Sequence:CCGGGGGCTCAAACACACCACACTTCTCGAGAAGTGTGGTGTGTTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-501s21c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-916s21c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006368
VALIDATED
CREB3 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006368.4-1688s1c1
Sequence:CCGGGCTCAAACACACCACACTTAACTCGAGTTAAGTGTGGTGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-1488s1c1
Sequence:CCGGGCAGGCAAATCTCACAAGGAACTCGAGTTCCTTGTGAGATTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-916s1c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-501s1c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-877s1c1
Sequence:CCGGCCTCTCACTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-882s21c1
Sequence:CCGGCACTAAGACAGAGGAACAAATCTCGAGATTTGTTCCTCTGTCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-1553s21c1
Sequence:CCGGACAGATACTCAGGCTAGATATCTCGAGATATCTAGCCTGAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006368.4-1686s21c1
Sequence:CCGGGGGCTCAAACACACCACACTTCTCGAGAAGTGTGGTGTGTTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-501s21c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-916s21c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006368
VALIDATED
CREB3 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006368.4-1688s1c1
Sequence:CCGGGCTCAAACACACCACACTTAACTCGAGTTAAGTGTGGTGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-1488s1c1
Sequence:CCGGGCAGGCAAATCTCACAAGGAACTCGAGTTCCTTGTGAGATTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-916s1c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-501s1c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006368.4-877s1c1
Sequence:CCGGCCTCTCACTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-882s21c1
Sequence:CCGGCACTAAGACAGAGGAACAAATCTCGAGATTTGTTCCTCTGTCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-1553s21c1
Sequence:CCGGACAGATACTCAGGCTAGATATCTCGAGATATCTAGCCTGAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006368.4-1686s21c1
Sequence:CCGGGGGCTCAAACACACCACACTTCTCGAGAAGTGTGGTGTGTTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-501s21c1
Sequence:CCGGGCTAGAGGAAAGTGGAGATTTCTCGAGAAATCTCCACTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006368.4-916s21c1
Sequence:CCGGCGGAGGAAGATTCGAAATAAACTCGAGTTTATTTCGAATCTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013497
VALIDATED
CREB3 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-637s1c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-1243s1c1
Sequence:CCGGCAGCCCTTCTTTGGTCATCTTCTCGAGAAGATGACCAAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-544s1c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-517s1c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-211s1c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-551s21c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-578s21c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-245s21c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-671s21c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013497
VALIDATED
CREB3 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-637s1c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-1243s1c1
Sequence:CCGGCAGCCCTTCTTTGGTCATCTTCTCGAGAAGATGACCAAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-544s1c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-517s1c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-211s1c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-551s21c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-578s21c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-245s21c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-671s21c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013497
VALIDATED
CREB3 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-637s1c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-1243s1c1
Sequence:CCGGCAGCCCTTCTTTGGTCATCTTCTCGAGAAGATGACCAAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-544s1c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-517s1c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013497.1-211s1c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-551s21c1
Sequence:CCGGACAGGAGATGTCTAGGCTGATCTCGAGATCAGCCTAGACATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-578s21c1
Sequence:CCGGCGAGGAAGAGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-245s21c1
Sequence:CCGGGCTAGAGGAAAGCGGAGATTTCTCGAGAAATCTCCGCTTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013497.3-671s21c1
Sequence:CCGGGCGGAGGAAGATTCGTAACAACTCGAGTTGTTACGAATCTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks