EMAIL THIS PAGE TO A FRIEND

CREB3L1

cAMP responsive element binding protein 3-like 1

97 Gene Product Result for
Synonyms: OASIS
UniProtKB ID: Q96BA8, Q8N2D5, Q96CP0
Gene ID:
Human(90993) Summary: The protein encoded by this gene is normally found in the membrane of the endoplasmic reticulum (ER). However, upon stress to the ER, the encoded protein is cleaved and the released cytoplasmic transcription factor domain translocates to the nucleus. There it activates the transcription of target genes by binding to box-B elements. [provided by RefSeq, Jun 2013]
Mouse(26427) cAMP responsive element binding protein 3-like 1
Rat(362165) cAMP responsive element binding protein 3-like 1
sheep(101113882) cAMP responsive element binding protein 3-like 1
Domestic Rabbit(100345475) cAMP responsive element binding protein 3-like 1
domestic guinea pig(100734327) cAMP responsive element binding protein 3-like 1
naked mole-rat(101698748) cAMP responsive element binding protein 3-like 1
Zebrafish(338317) cAMP responsive element binding protein 3-like 1
cow(513105) cAMP responsive element binding protein 3-like 1
Horse(100057002) cAMP responsive element binding protein 3-like 1
domestic cat(101087097) cAMP responsive element binding protein 3-like 1
dog(483636) cAMP responsive element binding protein 3-like 1
chicken(423198) cAMP responsive element binding protein 3-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052854 Rosetta Predictions human pricing
NM_001005562 Rosetta Predictions rat pricing
NM_011957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137411 predicted 791
2 SASI_Hs02_00361549 predicted 1356
3 SASI_Hs01_00137413 predicted 790
4 SASI_Hs01_00137414 predicted 1349
5 SASI_Hs01_00137415 predicted 2039
6 SASI_Hs01_00137416 predicted 1672
7 SASI_Hs01_00137417 predicted 690
8 SASI_Hs01_00137418 predicted 2205
9 SASI_Hs01_00137419 predicted 769
10 SASI_Hs01_00137420 predicted 959
11 SASI_Hs01_00137412 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054084 predicted 1812
2 SASI_Rn01_00054085 predicted 747
3 SASI_Rn01_00054086 predicted 766
4 SASI_Rn01_00054087 predicted 954
5 SASI_Rn01_00054089 predicted 1031
6 SASI_Rn02_00198425 predicted 1256
7 SASI_Rn01_00054090 predicted 1621
8 SASI_Rn01_00054091 predicted 1193
9 SASI_Rn01_00054092 predicted 919
10 SASI_Rn01_00054093 predicted 1838
11 SASI_Rn01_00054088 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095141 predicted 1319
2 SASI_Mm01_00095142 predicted 1294
3 SASI_Mm01_00095143 predicted 1186
4 SASI_Mm01_00095145 predicted 1474
5 SASI_Mm01_00095146 predicted 1001
6 SASI_Mm01_00095147 predicted 863
7 SASI_Mm01_00095148 predicted 415
8 SASI_Mm01_00095144 predicted 1569
9 SASI_Mm01_00095149 predicted 997
10 SASI_Mm01_00095150 predicted 1671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011957
CREB3L1 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1822s21c1
Sequence:CCGGTATCCGTCCTCCTCCGATAAACTCGAGTTTATCGGAGGAGGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011957.2-598s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1976s21c1
Sequence:CCGGAGAACAGAAATCGTTTGTAAACTCGAGTTTACAAACGATTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011957.1-1570s1c1
Sequence:CCGGCACCACCATCAAACTCTCCTACTCGAGTAGGAGAGTTTGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1224s1c1
Sequence:CCGGCGGCTCAATGACTGTGAAAGACTCGAGTCTTTCACAGTCATTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-96s1c1
Sequence:CCGGAGACCTGAATGAGTCGGATTTCTCGAGAAATCCGACTCATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1294s1c1
Sequence:CCGGCGAAGCCTACTGTTCTACGATCTCGAGATCGTAGAACAGTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-106s1c1
Sequence:CCGGGAGTCGGATTTCCTCAACAATCTCGAGATTGTTGAGGAAATCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011957
CREB3L1 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1822s21c1
Sequence:CCGGTATCCGTCCTCCTCCGATAAACTCGAGTTTATCGGAGGAGGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011957.2-598s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1976s21c1
Sequence:CCGGAGAACAGAAATCGTTTGTAAACTCGAGTTTACAAACGATTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011957.1-1570s1c1
Sequence:CCGGCACCACCATCAAACTCTCCTACTCGAGTAGGAGAGTTTGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1224s1c1
Sequence:CCGGCGGCTCAATGACTGTGAAAGACTCGAGTCTTTCACAGTCATTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-96s1c1
Sequence:CCGGAGACCTGAATGAGTCGGATTTCTCGAGAAATCCGACTCATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1294s1c1
Sequence:CCGGCGAAGCCTACTGTTCTACGATCTCGAGATCGTAGAACAGTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-106s1c1
Sequence:CCGGGAGTCGGATTTCCTCAACAATCTCGAGATTGTTGAGGAAATCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011957
CREB3L1 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1822s21c1
Sequence:CCGGTATCCGTCCTCCTCCGATAAACTCGAGTTTATCGGAGGAGGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011957.2-598s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011957.2-1976s21c1
Sequence:CCGGAGAACAGAAATCGTTTGTAAACTCGAGTTTACAAACGATTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011957.1-1570s1c1
Sequence:CCGGCACCACCATCAAACTCTCCTACTCGAGTAGGAGAGTTTGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1224s1c1
Sequence:CCGGCGGCTCAATGACTGTGAAAGACTCGAGTCTTTCACAGTCATTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-96s1c1
Sequence:CCGGAGACCTGAATGAGTCGGATTTCTCGAGAAATCCGACTCATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-1294s1c1
Sequence:CCGGCGAAGCCTACTGTTCTACGATCTCGAGATCGTAGAACAGTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011957.1-106s1c1
Sequence:CCGGGAGTCGGATTTCCTCAACAATCTCGAGATTGTTGAGGAAATCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052854
CREB3L1 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2207s21c1
Sequence:CCGGATCCGTCCTTCTCAGACAAACCTCGAGGTTTGTCTGAGAAGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2168s21c1
Sequence:CCGGCCGACCACTCTGTTCTCATTCCTCGAGGAATGAGAACAGAGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052854.2-968s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1025s1c1
Sequence:CCGGCGTCGTAAGAAGAAGGAGTATCTCGAGATACTCCTTCTTCTTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-305s1c1
Sequence:CCGGAGCCCTCTATTGGACATGGAACTCGAGTTCCATGTCCAATAGAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1370s1c1
Sequence:CCGGCGAAGCCTCCTATTCTACGATCTCGAGATCGTAGAATAGGAGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-182s1c1
Sequence:CCGGGAGTCGGACTTCCTCAACAATCTCGAGATTGTTGAGGAAGTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1177s1c1
Sequence:CCGGCAACAAGATCTCCAGACCTTACTCGAGTAAGGTCTGGAGATCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052854
CREB3L1 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2207s21c1
Sequence:CCGGATCCGTCCTTCTCAGACAAACCTCGAGGTTTGTCTGAGAAGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2168s21c1
Sequence:CCGGCCGACCACTCTGTTCTCATTCCTCGAGGAATGAGAACAGAGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052854.2-968s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1025s1c1
Sequence:CCGGCGTCGTAAGAAGAAGGAGTATCTCGAGATACTCCTTCTTCTTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-305s1c1
Sequence:CCGGAGCCCTCTATTGGACATGGAACTCGAGTTCCATGTCCAATAGAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1370s1c1
Sequence:CCGGCGAAGCCTCCTATTCTACGATCTCGAGATCGTAGAATAGGAGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-182s1c1
Sequence:CCGGGAGTCGGACTTCCTCAACAATCTCGAGATTGTTGAGGAAGTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1177s1c1
Sequence:CCGGCAACAAGATCTCCAGACCTTACTCGAGTAAGGTCTGGAGATCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052854
CREB3L1 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2207s21c1
Sequence:CCGGATCCGTCCTTCTCAGACAAACCTCGAGGTTTGTCTGAGAAGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052854.2-2168s21c1
Sequence:CCGGCCGACCACTCTGTTCTCATTCCTCGAGGAATGAGAACAGAGTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052854.2-968s21c1
Sequence:CCGGCTCAGCTGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1025s1c1
Sequence:CCGGCGTCGTAAGAAGAAGGAGTATCTCGAGATACTCCTTCTTCTTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-305s1c1
Sequence:CCGGAGCCCTCTATTGGACATGGAACTCGAGTTCCATGTCCAATAGAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1370s1c1
Sequence:CCGGCGAAGCCTCCTATTCTACGATCTCGAGATCGTAGAATAGGAGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-182s1c1
Sequence:CCGGGAGTCGGACTTCCTCAACAATCTCGAGATTGTTGAGGAAGTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052854.1-1177s1c1
Sequence:CCGGCAACAAGATCTCCAGACCTTACTCGAGTAAGGTCTGGAGATCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks