EMAIL THIS PAGE TO A FRIEND

CREB3L2

cAMP responsive element binding protein 3-like 2

207 Gene Product Result for
Synonyms: BBF2H7
UniProtKB ID: Q70SY1, Q6P454, Q6ZMR6
Gene ID:
Human(64764) Summary: This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(208647) cAMP responsive element binding protein 3-like 2
Rat(362339) cAMP responsive element binding protein 3-like 2
Zebrafish(791169) cAMP responsive element binding protein 3-like 2
cow(785086) cAMP responsive element binding protein 3-like 2
domestic cat(101100293) cAMP responsive element binding protein 3-like 2
dog(491369) cAMP responsive element binding protein 3-like 2
chicken(418123) cAMP responsive element binding protein 3-like 2
naked mole-rat(101715715) cAMP responsive element binding protein 3-like 2
domestic guinea pig(100713963) cAMP responsive element binding protein 3-like 2
sheep(101108743) cAMP responsive element binding protein 3-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194071 Rosetta Predictions human pricing
NM_001012188 Rosetta Predictions rat pricing
XM_575433 Rosetta Predictions rat pricing
NM_178661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186422 predicted 738
2 SASI_Hs01_00186423 predicted 1936
3 SASI_Hs01_00186424 predicted 1664
4 SASI_Hs01_00186425 predicted 927
5 SASI_Hs01_00186426 predicted 1409
6 SASI_Hs02_00371360 predicted 1415
7 SASI_Hs02_00371361 predicted 1665
8 SASI_Hs01_00186427 predicted 1404
9 SASI_Hs01_00186428 predicted 1370
10 SASI_Hs01_00186430 predicted 1426
11 SASI_Hs01_00186429 predicted 1293
12 SASI_Hs01_00186431 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036346 predicted 1235
2 SASI_Rn01_00036347 predicted 676
3 SASI_Rn01_00036348 predicted 768
4 SASI_Rn01_00036349 predicted 876
5 SASI_Rn01_00036350 predicted 1304
6 SASI_Rn01_00036351 predicted 845
7 SASI_Rn01_00036352 predicted 484
8 SASI_Rn01_00036353 predicted 417
9 SASI_Rn01_00036354 predicted 1987
10 SASI_Rn01_00036355 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165307 predicted 1245
2 SASI_Rn01_00165308 predicted 561
3 SASI_Rn01_00165309 predicted 682
4 SASI_Rn01_00165310 predicted 778
5 SASI_Rn01_00165311 predicted 882
6 SASI_Rn01_00165312 predicted 1315
7 SASI_Rn01_00165313 predicted 664
8 SASI_Rn01_00165314 predicted 851
9 SASI_Rn01_00165315 predicted 488
10 SASI_Rn01_00165316 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349115 predicted 559
2 SASI_Mm02_00349116 predicted 680
3 SASI_Mm01_00111123 predicted 1849
4 SASI_Mm01_00111125 predicted 1312
5 SASI_Mm01_00111126 predicted 1369
6 SASI_Mm01_00111127 predicted 1842
7 SASI_Mm01_00111128 predicted 1536
8 SASI_Mm01_00111129 predicted 1233
9 SASI_Mm01_00111130 predicted 912
10 SASI_Mm01_00111132 predicted 612
11 SASI_Mm01_00111124 predicted 1232
12 SASI_Mm01_00111131 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194071
VALIDATED
CREB3L2 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1358s1c1
Sequence:CCGGCGGAAGAAGGTAGAGGTTCTACTCGAGTAGAACCTCTACCTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-1634s1c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-720s1c1
Sequence:CCGGCCATCAAGACAGAGCCAATTACTCGAGTAATTGGCTCTGTCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1797s1c1
Sequence:CCGGGCCTGGAGAAGTCAGTGCTTTCTCGAGAAAGCACTGACTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-461s1c1
Sequence:CCGGTCAGAACTTCTGGATGAGTTTCTCGAGAAACTCATCCAGAAGTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1147s21c1
Sequence:CCGGTCCTCACGGCTCCTCATAAACCTCGAGGTTTATGAGGAGCCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1288s21c1
Sequence:CCGGTTCGGAGGAAGATCAAGAATACTCGAGTATTCTTGATCTTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194071.2-2361s21c1
Sequence:CCGGCATAATGCCTGTTGGTATTTGCTCGAGCAAATACCAACAGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-897s21c1
Sequence:CCGGTCCTCGTGCCAGACCATTATTCTCGAGAATAATGGTCTGGCACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1680s21c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194071
VALIDATED
CREB3L2 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1358s1c1
Sequence:CCGGCGGAAGAAGGTAGAGGTTCTACTCGAGTAGAACCTCTACCTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-1634s1c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-720s1c1
Sequence:CCGGCCATCAAGACAGAGCCAATTACTCGAGTAATTGGCTCTGTCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1797s1c1
Sequence:CCGGGCCTGGAGAAGTCAGTGCTTTCTCGAGAAAGCACTGACTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-461s1c1
Sequence:CCGGTCAGAACTTCTGGATGAGTTTCTCGAGAAACTCATCCAGAAGTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1147s21c1
Sequence:CCGGTCCTCACGGCTCCTCATAAACCTCGAGGTTTATGAGGAGCCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1288s21c1
Sequence:CCGGTTCGGAGGAAGATCAAGAATACTCGAGTATTCTTGATCTTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194071.2-2361s21c1
Sequence:CCGGCATAATGCCTGTTGGTATTTGCTCGAGCAAATACCAACAGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-897s21c1
Sequence:CCGGTCCTCGTGCCAGACCATTATTCTCGAGAATAATGGTCTGGCACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1680s21c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194071
VALIDATED
CREB3L2 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1358s1c1
Sequence:CCGGCGGAAGAAGGTAGAGGTTCTACTCGAGTAGAACCTCTACCTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-1634s1c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_194071.1-720s1c1
Sequence:CCGGCCATCAAGACAGAGCCAATTACTCGAGTAATTGGCTCTGTCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-1797s1c1
Sequence:CCGGGCCTGGAGAAGTCAGTGCTTTCTCGAGAAAGCACTGACTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194071.1-461s1c1
Sequence:CCGGTCAGAACTTCTGGATGAGTTTCTCGAGAAACTCATCCAGAAGTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1147s21c1
Sequence:CCGGTCCTCACGGCTCCTCATAAACCTCGAGGTTTATGAGGAGCCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1288s21c1
Sequence:CCGGTTCGGAGGAAGATCAAGAATACTCGAGTATTCTTGATCTTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194071.2-2361s21c1
Sequence:CCGGCATAATGCCTGTTGGTATTTGCTCGAGCAAATACCAACAGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-897s21c1
Sequence:CCGGTCCTCGTGCCAGACCATTATTCTCGAGAATAATGGTCTGGCACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_194071.2-1680s21c1
Sequence:CCGGCTGCTGATCTACGAGGAACATCTCGAGATGTTCCTCGTAGATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178661
VALIDATED
CREB3L2 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178661.2-2143s1c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-851s1c1
Sequence:CCGGCAGACGCTTATTCCTAAGATTCTCGAGAATCTTAGGAATAAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178661.2-1839s1c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-850s1c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-1321s1c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178661.3-2142s21c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1320s21c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1838s21c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-849s21c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178661
VALIDATED
CREB3L2 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178661.2-2143s1c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-851s1c1
Sequence:CCGGCAGACGCTTATTCCTAAGATTCTCGAGAATCTTAGGAATAAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178661.2-1839s1c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-850s1c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-1321s1c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178661.3-2142s21c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1320s21c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1838s21c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-849s21c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178661
VALIDATED
CREB3L2 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178661.2-2143s1c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-851s1c1
Sequence:CCGGCAGACGCTTATTCCTAAGATTCTCGAGAATCTTAGGAATAAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178661.2-1839s1c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-850s1c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178661.2-1321s1c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178661.3-2142s21c1
Sequence:CCGGGCAGGCTTGTTTCCACCAATACTCGAGTATTGGTGGAAACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1320s21c1
Sequence:CCGGGTCTTGTTCAACTGAGAACTTCTCGAGAAGTTCTCAGTTGAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-1838s21c1
Sequence:CCGGGCAAACTGGAAGGGAACGAAACTCGAGTTTCGTTCCCTTCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178661.3-849s21c1
Sequence:CCGGCCAGACGCTTATTCCTAAGATCTCGAGATCTTAGGAATAAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks