EMAIL THIS PAGE TO A FRIEND

CREB3L3

cAMP responsive element binding protein 3-like 3

57 Gene Product Result for
Synonyms: CREB-H CREBH
UniProtKB ID: Q68CJ9, B2R7S6, Q6ZMC5, Q96TB9
Gene ID:
Human(84699) Summary: This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(208677) cAMP responsive element binding protein 3-like 3
Rat(314638) cAMP responsive element binding protein 3-like 3
sheep(101113586) cAMP responsive element binding protein 3-like 3
domestic guinea pig(100728649) cAMP responsive element binding protein 3-like 3
naked mole-rat(101716023) cAMP responsive element binding protein 3-like 3
Zebrafish(553700) cAMP responsive element binding protein 3-like 3
chicken(428333) cAMP responsive element binding protein 3-like 3
cow(513010) cAMP responsive element binding protein 3-like 3
domestic cat(101089838) cAMP responsive element binding protein 3-like 3
dog(485046) cAMP responsive element binding protein 3-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017021 MISSION® esiRNA esiRNA targeting mouse Creb3l3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032607 Rosetta Predictions human pricing
NM_001012115 Rosetta Predictions rat pricing
XM_576179 Rosetta Predictions rat pricing
NM_145365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360161 predicted 1273
2 SASI_Hs01_00145059 predicted 1029
3 SASI_Hs01_00145060 predicted 491
4 SASI_Hs01_00145061 predicted 1169
5 SASI_Hs01_00145062 predicted 1281
6 SASI_Hs01_00145063 predicted 965
7 SASI_Hs01_00145066 predicted 1181
8 SASI_Hs02_00360162 predicted 1276
9 SASI_Hs01_00145067 predicted 1287
10 SASI_Hs01_00145068 predicted 870
11 SASI_Hs01_00145064 predicted 537
12 SASI_Hs01_00145065 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107499 predicted 1525
2 SASI_Rn01_00107500 predicted 457
3 SASI_Rn01_00107502 predicted 1619
4 SASI_Rn01_00107503 predicted 1282
5 SASI_Rn02_00200275 predicted 1629
6 SASI_Rn01_00107504 predicted 246
7 SASI_Rn01_00107505 predicted 226
8 SASI_Rn01_00107506 predicted 1664
9 SASI_Rn01_00107507 predicted 242
10 SASI_Rn01_00107508 predicted 323
11 SASI_Rn01_00107501 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131907 predicted 880
2 SASI_Rn01_00131908 predicted 540
3 SASI_Rn01_00131909 predicted 902
4 SASI_Rn01_00131910 predicted 660
5 SASI_Rn01_00131911 predicted 332
6 SASI_Rn01_00131912 predicted 302
7 SASI_Rn01_00131913 predicted 326
8 SASI_Rn01_00131914 predicted 407
9 SASI_Rn01_00131915 predicted 621
10 SASI_Rn01_00131916 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340645 predicted 1999
2 SASI_Mm01_00124399 predicted 1158
3 SASI_Mm01_00124400 predicted 590
4 SASI_Mm01_00124401 predicted 567
5 SASI_Mm01_00124402 predicted 1115
6 SASI_Mm01_00124403 predicted 2004
7 SASI_Mm01_00124404 predicted 1326
8 SASI_Mm01_00124405 predicted 883
9 SASI_Mm01_00124406 predicted 466
10 SASI_Mm01_00124408 predicted 1810
11 SASI_Mm01_00124407 predicted 1656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145365
CREB3L3 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145365.3-1995s21c1
Sequence:CCGGTGCAGACAGACTGACACTAACCTCGAGGTTAGTGTCAGTCTGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1428s21c1
Sequence:CCGGGCCCTTTCAACTCCAACAAAGCTCGAGCTTTGTTGGAGTTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1829s21c1
Sequence:CCGGCGTCTGGTGCAAGATGCATTGCTCGAGCAATGCATCTTGCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1466s21c1
Sequence:CCGGTTCGTGCCAGTGCGAGTGTTTCTCGAGAAACACTCGCACTGGCACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145365.2-2116s1c1
Sequence:CCGGCCCACAAACTTCCATCTTCCTCTCGAGAGGAAGATGGAAGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1164s1c1
Sequence:CCGGCGGAACAAACAGTCAGCTCAACTCGAGTTGAGCTGACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-576s1c1
Sequence:CCGGGAGCAGAAAGTTCTACTAAATCTCGAGATTTAGTAGAACTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1804s1c1
Sequence:CCGGCCTGGGTACCAAGGTGGCTTACTCGAGTAAGCCACCTTGGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1113s1c1
Sequence:CCGGCCTCTCACCAAGTATGAGGAACTCGAGTTCCTCATACTTGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145365
CREB3L3 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145365.3-1995s21c1
Sequence:CCGGTGCAGACAGACTGACACTAACCTCGAGGTTAGTGTCAGTCTGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1428s21c1
Sequence:CCGGGCCCTTTCAACTCCAACAAAGCTCGAGCTTTGTTGGAGTTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1829s21c1
Sequence:CCGGCGTCTGGTGCAAGATGCATTGCTCGAGCAATGCATCTTGCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1466s21c1
Sequence:CCGGTTCGTGCCAGTGCGAGTGTTTCTCGAGAAACACTCGCACTGGCACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145365.2-2116s1c1
Sequence:CCGGCCCACAAACTTCCATCTTCCTCTCGAGAGGAAGATGGAAGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1164s1c1
Sequence:CCGGCGGAACAAACAGTCAGCTCAACTCGAGTTGAGCTGACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-576s1c1
Sequence:CCGGGAGCAGAAAGTTCTACTAAATCTCGAGATTTAGTAGAACTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1804s1c1
Sequence:CCGGCCTGGGTACCAAGGTGGCTTACTCGAGTAAGCCACCTTGGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1113s1c1
Sequence:CCGGCCTCTCACCAAGTATGAGGAACTCGAGTTCCTCATACTTGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145365
CREB3L3 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145365.3-1995s21c1
Sequence:CCGGTGCAGACAGACTGACACTAACCTCGAGGTTAGTGTCAGTCTGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1428s21c1
Sequence:CCGGGCCCTTTCAACTCCAACAAAGCTCGAGCTTTGTTGGAGTTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1829s21c1
Sequence:CCGGCGTCTGGTGCAAGATGCATTGCTCGAGCAATGCATCTTGCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145365.3-1466s21c1
Sequence:CCGGTTCGTGCCAGTGCGAGTGTTTCTCGAGAAACACTCGCACTGGCACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145365.2-2116s1c1
Sequence:CCGGCCCACAAACTTCCATCTTCCTCTCGAGAGGAAGATGGAAGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1164s1c1
Sequence:CCGGCGGAACAAACAGTCAGCTCAACTCGAGTTGAGCTGACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-576s1c1
Sequence:CCGGGAGCAGAAAGTTCTACTAAATCTCGAGATTTAGTAGAACTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1804s1c1
Sequence:CCGGCCTGGGTACCAAGGTGGCTTACTCGAGTAAGCCACCTTGGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145365.2-1113s1c1
Sequence:CCGGCCTCTCACCAAGTATGAGGAACTCGAGTTCCTCATACTTGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032607
CREB3L3 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-874s21c1
Sequence:CCGGACAAGCAGTCGGCGCAAGAAACTCGAGTTTCTTGCGCCGACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-187s21c1
Sequence:CCGGAGCTCCTGGATCTCCTGTTTGCTCGAGCAAACAGGAGATCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-531s1c1
Sequence:CCGGCCAGTGATCCAAGTACCTGAACTCGAGTTCAGGTACTTGGATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1089s1c1
Sequence:CCGGGCAGTCCTGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1194s1c1
Sequence:CCGGTCCAGAACTTTGCACAACGATCTCGAGATCGTTGTGCAAAGTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032607
CREB3L3 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-874s21c1
Sequence:CCGGACAAGCAGTCGGCGCAAGAAACTCGAGTTTCTTGCGCCGACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-187s21c1
Sequence:CCGGAGCTCCTGGATCTCCTGTTTGCTCGAGCAAACAGGAGATCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-531s1c1
Sequence:CCGGCCAGTGATCCAAGTACCTGAACTCGAGTTCAGGTACTTGGATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1089s1c1
Sequence:CCGGGCAGTCCTGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1194s1c1
Sequence:CCGGTCCAGAACTTTGCACAACGATCTCGAGATCGTTGTGCAAAGTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032607
CREB3L3 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-874s21c1
Sequence:CCGGACAAGCAGTCGGCGCAAGAAACTCGAGTTTCTTGCGCCGACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032607.1-187s21c1
Sequence:CCGGAGCTCCTGGATCTCCTGTTTGCTCGAGCAAACAGGAGATCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-531s1c1
Sequence:CCGGCCAGTGATCCAAGTACCTGAACTCGAGTTCAGGTACTTGGATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1089s1c1
Sequence:CCGGGCAGTCCTGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032607.1-1194s1c1
Sequence:CCGGTCCAGAACTTTGCACAACGATCTCGAGATCGTTGTGCAAAGTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks