EMAIL THIS PAGE TO A FRIEND

CREB3L4

cAMP responsive element binding protein 3-like 4

89 Gene Product Result for
Synonyms: AIBZIP ATCE1 CREB3 CREB4 JAL hJAL
UniProtKB ID: Q8TEY5, D3DV62, Q5T4L0, Q86YW6
Gene ID:
Human(148327) Summary: This gene encodes a CREB (cAMP responsive element binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein is a transcriptional activator which contains a dimerization domain, and this protein may function in a number of processing pathways including protein processing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(78284) cAMP responsive element binding protein 3-like 4
Rat(310616) cAMP responsive element binding protein 3-like 4
dog(612303) cAMP responsive element binding protein 3-like 4
Horse(100062307) cAMP responsive element binding protein 3-like 4
cow(529566) cAMP responsive element binding protein 3-like 4
domestic cat(101100442) cAMP responsive element binding protein 3-like 4
naked mole-rat(101706643) cAMP responsive element binding protein 3-like 4
domestic guinea pig(100729390) cAMP responsive element binding protein 3-like 4
sheep(101107485) cAMP responsive element binding protein 3-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130898 Rosetta Predictions human pricing
NM_001007093 Rosetta Predictions rat pricing
XM_579170 Rosetta Predictions rat pricing
NM_030080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231689 predicted 695
2 SASI_Hs01_00231690 predicted 662
3 SASI_Hs01_00231691 predicted 588
4 SASI_Hs01_00231693 predicted 1355
5 SASI_Hs01_00231694 predicted 491
6 SASI_Hs01_00231696 predicted 658
7 SASI_Hs01_00231697 predicted 1486
8 SASI_Hs02_00362909 predicted 592
9 SASI_Hs02_00362910 predicted 1020
10 SASI_Hs01_00231698 predicted 1233
11 SASI_Hs01_00231692 predicted 1034
12 SASI_Hs01_00231695 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083952 predicted 551
2 SASI_Rn01_00083954 predicted 408
3 SASI_Rn01_00083955 predicted 246
4 SASI_Rn01_00083956 predicted 391
5 SASI_Rn01_00083957 predicted 303
6 SASI_Rn01_00083958 predicted 335
7 SASI_Rn01_00083959 predicted 799
8 SASI_Rn01_00083960 predicted 257
9 SASI_Rn01_00083961 predicted 352
10 SASI_Rn02_00198615 predicted 584
11 SASI_Rn01_00083953 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134707 predicted 315
2 SASI_Rn01_00134708 predicted 406
3 SASI_Rn01_00134709 predicted 388
4 SASI_Rn01_00134710 predicted 312
5 SASI_Rn01_00134711 predicted 344
6 SASI_Rn01_00134712 predicted 340
7 SASI_Rn01_00134713 predicted 301
8 SASI_Rn01_00134714 predicted 387
9 SASI_Rn01_00134715 predicted 406
10 SASI_Rn01_00134716 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336469 predicted 1128
2 SASI_Mm01_00171600 predicted 1104
3 SASI_Mm01_00171601 predicted 1131
4 SASI_Mm01_00171602 predicted 462
5 SASI_Mm01_00171603 predicted 1308
6 SASI_Mm01_00171604 predicted 620
7 SASI_Mm01_00171605 predicted 1313
8 SASI_Mm01_00171606 predicted 1248
9 SASI_Mm02_00336470 predicted 1123
10 SASI_Mm01_00171608 predicted 463
11 SASI_Mm01_00171599 predicted 1305
12 SASI_Mm01_00171607 predicted 1148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130898
CREB3L4 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1258s1c1
Sequence:CCGGCGGAGTGACTTCCAGAAATATCTCGAGATATTTCTGGAAGTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1031s1c1
Sequence:CCGGCAGAACCAAGAATTACAGAAACTCGAGTTTCTGTAATTCTTGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-920s1c1
Sequence:CCGGCTCAAGAAGGTCAGGAGGAAACTCGAGTTTCCTCCTGACCTTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-701s1c1
Sequence:CCGGCCAGCATTTATGGTGCCTGATCTCGAGATCAGGCACCATAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1110s1c1
Sequence:CCGGAGACGCTAATTGCTCAAACTTCTCGAGAAGTTTGAGCAATTAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-600s21c1
Sequence:CCGGTGCTCTATGAGGTTGTCTATGCTCGAGCATAGACAACCTCATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130898.2-1525s21c1
Sequence:CCGGCCCACTGGGATTCCTACTTAGCTCGAGCTAAGTAGGAATCCCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-1281s21c1
Sequence:CCGGTGACCCACAAGGACGTAACAGCTCGAGCTGTTACGTCCTTGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130898
CREB3L4 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1258s1c1
Sequence:CCGGCGGAGTGACTTCCAGAAATATCTCGAGATATTTCTGGAAGTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1031s1c1
Sequence:CCGGCAGAACCAAGAATTACAGAAACTCGAGTTTCTGTAATTCTTGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-920s1c1
Sequence:CCGGCTCAAGAAGGTCAGGAGGAAACTCGAGTTTCCTCCTGACCTTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-701s1c1
Sequence:CCGGCCAGCATTTATGGTGCCTGATCTCGAGATCAGGCACCATAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1110s1c1
Sequence:CCGGAGACGCTAATTGCTCAAACTTCTCGAGAAGTTTGAGCAATTAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-600s21c1
Sequence:CCGGTGCTCTATGAGGTTGTCTATGCTCGAGCATAGACAACCTCATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130898.2-1525s21c1
Sequence:CCGGCCCACTGGGATTCCTACTTAGCTCGAGCTAAGTAGGAATCCCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-1281s21c1
Sequence:CCGGTGACCCACAAGGACGTAACAGCTCGAGCTGTTACGTCCTTGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130898
CREB3L4 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1258s1c1
Sequence:CCGGCGGAGTGACTTCCAGAAATATCTCGAGATATTTCTGGAAGTCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1031s1c1
Sequence:CCGGCAGAACCAAGAATTACAGAAACTCGAGTTTCTGTAATTCTTGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-920s1c1
Sequence:CCGGCTCAAGAAGGTCAGGAGGAAACTCGAGTTTCCTCCTGACCTTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-701s1c1
Sequence:CCGGCCAGCATTTATGGTGCCTGATCTCGAGATCAGGCACCATAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130898.2-1110s1c1
Sequence:CCGGAGACGCTAATTGCTCAAACTTCTCGAGAAGTTTGAGCAATTAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-600s21c1
Sequence:CCGGTGCTCTATGAGGTTGTCTATGCTCGAGCATAGACAACCTCATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130898.2-1525s21c1
Sequence:CCGGCCCACTGGGATTCCTACTTAGCTCGAGCTAAGTAGGAATCCCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130898.2-1281s21c1
Sequence:CCGGTGACCCACAAGGACGTAACAGCTCGAGCTGTTACGTCCTTGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030080
CREB3L4 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 3-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030080.1-1380s1c1
Sequence:CCGGGCACCTCAAATGCTTGTCATACTCGAGTATGACAAGCATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-1108s1c1
Sequence:CCGGCCCGAGGATTATCAGCTTCATCTCGAGATGAAGCTGATAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-534s1c1
Sequence:CCGGCGGACTCATCTCTATTCAGATCTCGAGATCTGAATAGAGATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-343s1c1
Sequence:CCGGGACGATTTCCTGAACCTCTTTCTCGAGAAAGAGGTTCAGGAAATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-466s1c1
Sequence:CCGGGCCCTCTATGAGGTTGTCTATCTCGAGATAGACAACCTCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030080
CREB3L4 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 3-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030080.1-1380s1c1
Sequence:CCGGGCACCTCAAATGCTTGTCATACTCGAGTATGACAAGCATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-1108s1c1
Sequence:CCGGCCCGAGGATTATCAGCTTCATCTCGAGATGAAGCTGATAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-534s1c1
Sequence:CCGGCGGACTCATCTCTATTCAGATCTCGAGATCTGAATAGAGATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-343s1c1
Sequence:CCGGGACGATTTCCTGAACCTCTTTCTCGAGAAAGAGGTTCAGGAAATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-466s1c1
Sequence:CCGGGCCCTCTATGAGGTTGTCTATCTCGAGATAGACAACCTCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030080
CREB3L4 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 3-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030080.1-1380s1c1
Sequence:CCGGGCACCTCAAATGCTTGTCATACTCGAGTATGACAAGCATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-1108s1c1
Sequence:CCGGCCCGAGGATTATCAGCTTCATCTCGAGATGAAGCTGATAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-534s1c1
Sequence:CCGGCGGACTCATCTCTATTCAGATCTCGAGATCTGAATAGAGATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-343s1c1
Sequence:CCGGGACGATTTCCTGAACCTCTTTCTCGAGAAAGAGGTTCAGGAAATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030080.1-466s1c1
Sequence:CCGGGCCCTCTATGAGGTTGTCTATCTCGAGATAGACAACCTCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks