EMAIL THIS PAGE TO A FRIEND

CREB5

cAMP responsive element binding protein 5

353 Gene Product Result for
Synonyms: CRE-BPA
Gene ID:
Human(9586) Summary: The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(231991) cAMP responsive element binding protein 5
Rat(500131) cAMP responsive element binding protein 5
sheep(101112976) cAMP responsive element binding protein 5
domestic guinea pig(100719318) cAMP responsive element binding protein 5
naked mole-rat(101703315) cAMP responsive element binding protein 5
chicken(428435) cAMP responsive element binding protein 5
cow(534129) cAMP responsive element binding protein 5
Horse(100054803) cAMP responsive element binding protein 5
domestic cat(101084784) cAMP responsive element binding protein 5
dog(475266) cAMP responsive element binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011666 Rosetta Predictions human pricing
NM_004904 Rosetta Predictions human pricing
NM_182898 Rosetta Predictions human pricing
NM_182899 Rosetta Predictions human pricing
NM_001134621 Rosetta Predictions rat pricing
NM_172728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169584 predicted 1240
2 SASI_Hs01_00169585 predicted 1366
3 SASI_Hs01_00169586 predicted 815
4 SASI_Hs01_00169587 predicted 1247
5 SASI_Hs01_00169588 predicted 1033
6 SASI_Hs01_00169589 predicted 1189
7 SASI_Hs01_00169591 predicted 1341
8 SASI_Hs02_00306009 predicted 1130
9 SASI_Hs01_00169592 predicted 1045
10 SASI_Hs02_00306010 predicted 1249
11 SASI_Hs01_00169583 predicted 1436
12 SASI_Hs01_00169590 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030980 predicted 1676
2 SASI_Hs01_00030981 predicted 1802
3 SASI_Hs01_00030982 predicted 1252
4 SASI_Hs01_00030983 predicted 1691
5 SASI_Hs01_00030984 predicted 1480
6 SASI_Hs01_00030985 predicted 1635
7 SASI_Hs01_00030987 predicted 1783
8 SASI_Hs02_00338553 predicted 1577
9 SASI_Hs01_00030988 predicted 1490
10 SASI_Hs02_00338554 predicted 1684
11 SASI_Hs01_00030979 predicted 1872
12 SASI_Hs01_00030986 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240847 predicted 1999
2 SASI_Hs01_00240848 predicted 2123
3 SASI_Hs01_00240849 predicted 1571
4 SASI_Hs01_00240850 predicted 2003
5 SASI_Hs01_00240851 predicted 1795
6 SASI_Hs01_00240852 predicted 1948
7 SASI_Hs01_00240854 predicted 2104
8 SASI_Hs02_00370992 predicted 1894
9 SASI_Hs01_00240855 predicted 1804
10 SASI_Hs02_00370993 predicted 2001
11 SASI_Hs01_00240846 predicted 2192
12 SASI_Hs01_00240853 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095995 predicted 1654
2 SASI_Hs01_00095996 predicted 1778
3 SASI_Hs01_00095997 predicted 1227
4 SASI_Hs01_00095998 predicted 1668
5 SASI_Hs01_00095999 predicted 1449
6 SASI_Hs01_00096000 predicted 1606
7 SASI_Hs01_00096002 predicted 1754
8 SASI_Hs02_00370994 predicted 1553
9 SASI_Hs01_00096003 predicted 1460
10 SASI_Hs02_00370995 predicted 1664
11 SASI_Hs01_00095994 predicted 1851
12 SASI_Hs01_00096001 predicted 1710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257689 predicted 1790
2 SASI_Rn02_00257690 predicted 1572
3 SASI_Rn02_00257691 predicted 399
4 SASI_Rn02_00257692 predicted 1566
5 SASI_Rn02_00257693 predicted 380
6 SASI_Rn02_00257694 predicted 1600
7 SASI_Rn02_00257695 predicted 346
8 SASI_Rn02_00257696 predicted 1493
9 SASI_Rn02_00257697 predicted 1756
10 SASI_Rn02_00257698 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063468 predicted 883
2 SASI_Mm01_00063470 predicted 944
3 SASI_Mm01_00063471 predicted 1437
4 SASI_Mm01_00063472 predicted 1520
5 SASI_Mm02_00344534 predicted 1539
6 SASI_Mm01_00063473 predicted 1486
7 SASI_Mm01_00063474 predicted 919
8 SASI_Mm01_00063475 predicted 1509
9 SASI_Mm02_00344535 predicted 841
10 SASI_Mm01_00063477 predicted 1454
11 SASI_Mm01_00063469 predicted 894
12 SASI_Mm01_00063476 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004904
VALIDATED
CREB5 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1577s21c1
Sequence:CCGGAGACCTGAATCCGATTCTTTACTCGAGTAAAGAATCGGATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-656s21c1
Sequence:CCGGGATGCCAATGGAGCGACAAATCTCGAGATTTGTCGCTCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1360s21c1
Sequence:CCGGAGCTGAAACAGTTGTTGTTAACTCGAGTTAACAACAACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004904.1-2066s1c1
Sequence:CCGGCCAGATAAACACACAGCCTTTCTCGAGAAAGGCTGTGTGTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-360s1c1
Sequence:CCGGGCGGAATATCTCGATGCATAACTCGAGTTATGCATCGAGATATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004904.1-1482s1c1
Sequence:CCGGGCAACAAGTCATCCAGCATAACTCGAGTTATGCTGGATGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-1405s1c1
Sequence:CCGGGCCATGCAGAAAGAATCACAACTCGAGTTGTGATTCTTTCTGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-211s1c1
Sequence:CCGGCCTTCAATAAAGACAGACAATCTCGAGATTGTCTGTCTTTATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004904
VALIDATED
CREB5 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1577s21c1
Sequence:CCGGAGACCTGAATCCGATTCTTTACTCGAGTAAAGAATCGGATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-656s21c1
Sequence:CCGGGATGCCAATGGAGCGACAAATCTCGAGATTTGTCGCTCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1360s21c1
Sequence:CCGGAGCTGAAACAGTTGTTGTTAACTCGAGTTAACAACAACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004904.1-2066s1c1
Sequence:CCGGCCAGATAAACACACAGCCTTTCTCGAGAAAGGCTGTGTGTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-360s1c1
Sequence:CCGGGCGGAATATCTCGATGCATAACTCGAGTTATGCATCGAGATATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004904.1-1482s1c1
Sequence:CCGGGCAACAAGTCATCCAGCATAACTCGAGTTATGCTGGATGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-1405s1c1
Sequence:CCGGGCCATGCAGAAAGAATCACAACTCGAGTTGTGATTCTTTCTGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-211s1c1
Sequence:CCGGCCTTCAATAAAGACAGACAATCTCGAGATTGTCTGTCTTTATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004904
VALIDATED
CREB5 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1577s21c1
Sequence:CCGGAGACCTGAATCCGATTCTTTACTCGAGTAAAGAATCGGATTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-656s21c1
Sequence:CCGGGATGCCAATGGAGCGACAAATCTCGAGATTTGTCGCTCCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004904.2-1360s21c1
Sequence:CCGGAGCTGAAACAGTTGTTGTTAACTCGAGTTAACAACAACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004904.1-2066s1c1
Sequence:CCGGCCAGATAAACACACAGCCTTTCTCGAGAAAGGCTGTGTGTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-360s1c1
Sequence:CCGGGCGGAATATCTCGATGCATAACTCGAGTTATGCATCGAGATATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004904.1-1482s1c1
Sequence:CCGGGCAACAAGTCATCCAGCATAACTCGAGTTATGCTGGATGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-1405s1c1
Sequence:CCGGGCCATGCAGAAAGAATCACAACTCGAGTTGTGATTCTTTCTGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004904.1-211s1c1
Sequence:CCGGCCTTCAATAAAGACAGACAATCTCGAGATTGTCTGTCTTTATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172728
CREB5 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172728.1-2644s1c1
Sequence:CCGGCCCAAATAATTCACCTCCTAACTCGAGTTAGGAGGTGAATTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-850s1c1
Sequence:CCGGGCTTCAGAATGAAGTGTCCATCTCGAGATGGACACTTCATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-941s1c1
Sequence:CCGGCAGAAAGAATCCCAAGGGTATCTCGAGATACCCTTGGGATTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-898s1c1
Sequence:CCGGGCAGTTGTTGTTAACACATAACTCGAGTTATGTGTTAACAACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-166s1c1
Sequence:CCGGGCCAGGATCTTCTGCCGTCTTCTCGAGAAGACGGCAGAAGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172728.2-1351s21c1
Sequence:CCGGGTTGGTGCTTCTCTGCAATTTCTCGAGAAATTGCAGAGAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172728.2-1103s21c1
Sequence:CCGGGAACAGACCTGAATCCTATTCCTCGAGGAATAGGATTCAGGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172728
CREB5 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172728.1-2644s1c1
Sequence:CCGGCCCAAATAATTCACCTCCTAACTCGAGTTAGGAGGTGAATTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-850s1c1
Sequence:CCGGGCTTCAGAATGAAGTGTCCATCTCGAGATGGACACTTCATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-941s1c1
Sequence:CCGGCAGAAAGAATCCCAAGGGTATCTCGAGATACCCTTGGGATTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-898s1c1
Sequence:CCGGGCAGTTGTTGTTAACACATAACTCGAGTTATGTGTTAACAACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-166s1c1
Sequence:CCGGGCCAGGATCTTCTGCCGTCTTCTCGAGAAGACGGCAGAAGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172728.2-1351s21c1
Sequence:CCGGGTTGGTGCTTCTCTGCAATTTCTCGAGAAATTGCAGAGAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172728.2-1103s21c1
Sequence:CCGGGAACAGACCTGAATCCTATTCCTCGAGGAATAGGATTCAGGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172728
CREB5 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172728.1-2644s1c1
Sequence:CCGGCCCAAATAATTCACCTCCTAACTCGAGTTAGGAGGTGAATTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-850s1c1
Sequence:CCGGGCTTCAGAATGAAGTGTCCATCTCGAGATGGACACTTCATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-941s1c1
Sequence:CCGGCAGAAAGAATCCCAAGGGTATCTCGAGATACCCTTGGGATTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-898s1c1
Sequence:CCGGGCAGTTGTTGTTAACACATAACTCGAGTTATGTGTTAACAACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172728.1-166s1c1
Sequence:CCGGGCCAGGATCTTCTGCCGTCTTCTCGAGAAGACGGCAGAAGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172728.2-1351s21c1
Sequence:CCGGGTTGGTGCTTCTCTGCAATTTCTCGAGAAATTGCAGAGAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172728.2-1103s21c1
Sequence:CCGGGAACAGACCTGAATCCTATTCCTCGAGGAATAGGATTCAGGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks