EMAIL THIS PAGE TO A FRIEND

CREBBP

CREB binding protein

164 Gene Product Result for
Synonyms: CBP KAT3A RSTS
UniProtKB ID: Q92793, D3DUC9, O00147, Q16376, Q4LE28
Gene ID:
Human(1387) Summary: This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Mouse(12914) CREB binding protein
Rat(54244) CREB binding protein
Zebrafish(100535787) CREB binding protein
dog(479866) CREB binding protein
Horse(100069613) CREB binding protein
domestic cat(101094471) CREB binding protein
chicken(416667) CREB binding protein
cow(505453) CREB binding protein
naked mole-rat(101714025) CREB binding protein
domestic guinea pig(100716770) CREB binding protein
sheep(101123600) CREB binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_148699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_148699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_148699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079846 Rosetta Predictions human pricing
NM_004380 Rosetta Predictions human pricing
NM_133381 Rosetta Predictions rat pricing
NM_001025432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313900 predicted 3760
2 SASI_Hs02_00313901 predicted 2373
3 SASI_Hs02_00313902 predicted 4449
4 SASI_Hs02_00313903 predicted 771
5 SASI_Hs02_00313904 predicted 2423
6 SASI_Hs02_00313905 predicted 4423
7 SASI_Hs02_00313906 predicted 1091
8 SASI_Hs02_00313907 predicted 3376
9 SASI_Hs02_00313908 predicted 4256
10 SASI_Hs02_00313909 predicted 3768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188830 predicted 3873
2 SASI_Hs02_00337467 predicted 2484
3 SASI_Hs02_00337468 predicted 4554
4 SASI_Hs01_00188831 predicted 775
5 SASI_Hs01_00188832 predicted 2534
6 SASI_Hs01_00188833 predicted 4544
7 SASI_Hs02_00337469 predicted 1098
8 SASI_Hs01_00188837 predicted 3487
9 SASI_Hs01_00188838 predicted 4371
10 SASI_Hs02_00337470 predicted 3881
11 SASI_Hs01_00188834 predicted 1405
12 SASI_Hs01_00188835 predicted 1596
13 SASI_Hs01_00188836 predicted 1416
14 SASI_Hs01_00188839 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079791 predicted 738
2 SASI_Rn01_00079793 predicted 1624
3 SASI_Rn01_00079794 predicted 585
4 SASI_Rn01_00079795 predicted 5196
5 SASI_Rn01_00079796 predicted 6340
6 SASI_Rn01_00079797 predicted 1410
7 SASI_Rn01_00079798 predicted 1237
8 SASI_Rn01_00079799 predicted 4294
9 SASI_Rn01_00079800 predicted 3523
10 SASI_Rn02_00267643 predicted 1250
11 SASI_Rn01_00079792 predicted 6309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287878 predicted 2464
2 SASI_Mm01_00162905 predicted 3828
3 SASI_Mm01_00162906 predicted 745
4 SASI_Mm01_00162907 predicted 5354
5 SASI_Mm01_00162908 predicted 3767
6 SASI_Mm01_00162909 predicted 6494
7 SASI_Mm01_00162910 predicted 4578
8 SASI_Mm01_00162911 predicted 1389
9 SASI_Mm01_00162912 predicted 3996
10 SASI_Mm01_00162913 predicted 539
11 SASI_Mm01_00162914 predicted 1419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004380
CREBBP MISSION shRNA Bacterial Glycerol Stock
CREB binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004380.1-7983s1c1
Sequence:CCGGCCCGATAACTTTGTGATGTTTCTCGAGAAACATCACAAAGTTATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-3884s1c1
Sequence:CCGGGCTATCAGAATAGGTATCATTCTCGAGAATGATACCTATTCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-4541s1c1
Sequence:CCGGCCGTTTACCATGAGATCCTTACTCGAGTAAGGATCTCATGGTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-2211s1c1
Sequence:CCGGGCGTTTACATAAACAAGGCATCTCGAGATGCCTTGTTTATGTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-1161s1c1
Sequence:CCGGCGTGCCAAATATGTCTCAGATCTCGAGATCTGAGACATATTTGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-777s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-2144s21c1
Sequence:CCGGGGGATGAATATTATCACTTATCTCGAGATAAGTGATAATATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-7207s21c1
Sequence:CCGGATCGCCACGTCCCTTAGTAACCTCGAGGTTACTAAGGGACGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-4548s21c1
Sequence:CCGGCGTTTACCATGAGATCCTTATCTCGAGATAAGGATCTCATGGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004380
CREBBP MISSION shRNA shRNA Plasmid DNA
CREB binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004380.1-7983s1c1
Sequence:CCGGCCCGATAACTTTGTGATGTTTCTCGAGAAACATCACAAAGTTATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-3884s1c1
Sequence:CCGGGCTATCAGAATAGGTATCATTCTCGAGAATGATACCTATTCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-4541s1c1
Sequence:CCGGCCGTTTACCATGAGATCCTTACTCGAGTAAGGATCTCATGGTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-2211s1c1
Sequence:CCGGGCGTTTACATAAACAAGGCATCTCGAGATGCCTTGTTTATGTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-1161s1c1
Sequence:CCGGCGTGCCAAATATGTCTCAGATCTCGAGATCTGAGACATATTTGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-777s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-2144s21c1
Sequence:CCGGGGGATGAATATTATCACTTATCTCGAGATAAGTGATAATATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-7207s21c1
Sequence:CCGGATCGCCACGTCCCTTAGTAACCTCGAGGTTACTAAGGGACGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-4548s21c1
Sequence:CCGGCGTTTACCATGAGATCCTTATCTCGAGATAAGGATCTCATGGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004380
CREBBP MISSION shRNA Lentiviral Transduction Particles
CREB binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004380.1-7983s1c1
Sequence:CCGGCCCGATAACTTTGTGATGTTTCTCGAGAAACATCACAAAGTTATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-3884s1c1
Sequence:CCGGGCTATCAGAATAGGTATCATTCTCGAGAATGATACCTATTCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-4541s1c1
Sequence:CCGGCCGTTTACCATGAGATCCTTACTCGAGTAAGGATCTCATGGTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-2211s1c1
Sequence:CCGGGCGTTTACATAAACAAGGCATCTCGAGATGCCTTGTTTATGTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004380.1-1161s1c1
Sequence:CCGGCGTGCCAAATATGTCTCAGATCTCGAGATCTGAGACATATTTGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-777s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-2144s21c1
Sequence:CCGGGGGATGAATATTATCACTTATCTCGAGATAAGTGATAATATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-7207s21c1
Sequence:CCGGATCGCCACGTCCCTTAGTAACCTCGAGGTTACTAAGGGACGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004380.2-4548s21c1
Sequence:CCGGCGTTTACCATGAGATCCTTATCTCGAGATAAGGATCTCATGGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_148699
VALIDATED
CREBBP MISSION shRNA Bacterial Glycerol Stock
CREB binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-4387s1c1
Sequence:CCGGCCGGGAATGAAGTCAAGGTTTCTCGAGAAACCTTGACTTCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-207s1c1
Sequence:CCGGCGCGAATGACAACACAGATTTCTCGAGAAATCTGTGTTGTCATTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-7277s1c1
Sequence:CCGGCCCTTAGTAACCAGACTGGTTCTCGAGAACCAGTCTGGTTACTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-3482s1c1
Sequence:CCGGCCTCACAATCAACATCTCCTTCTCGAGAAGGAGATGTTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-2110s1c1
Sequence:CCGGCGGAGTCATCTAGTCCATAAACTCGAGTTTATGGACTAGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_148699
VALIDATED
CREBBP MISSION shRNA shRNA Plasmid DNA
CREB binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-4387s1c1
Sequence:CCGGCCGGGAATGAAGTCAAGGTTTCTCGAGAAACCTTGACTTCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-207s1c1
Sequence:CCGGCGCGAATGACAACACAGATTTCTCGAGAAATCTGTGTTGTCATTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-7277s1c1
Sequence:CCGGCCCTTAGTAACCAGACTGGTTCTCGAGAACCAGTCTGGTTACTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-3482s1c1
Sequence:CCGGCCTCACAATCAACATCTCCTTCTCGAGAAGGAGATGTTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-2110s1c1
Sequence:CCGGCGGAGTCATCTAGTCCATAAACTCGAGTTTATGGACTAGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_148699
VALIDATED
CREBBP MISSION shRNA Lentiviral Transduction Particles
CREB binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-4387s1c1
Sequence:CCGGCCGGGAATGAAGTCAAGGTTTCTCGAGAAACCTTGACTTCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-207s1c1
Sequence:CCGGCGCGAATGACAACACAGATTTCTCGAGAAATCTGTGTTGTCATTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-7277s1c1
Sequence:CCGGCCCTTAGTAACCAGACTGGTTCTCGAGAACCAGTCTGGTTACTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148699.3-3482s1c1
Sequence:CCGGCCTCACAATCAACATCTCCTTCTCGAGAAGGAGATGTTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_148699.3-2110s1c1
Sequence:CCGGCGGAGTCATCTAGTCCATAAACTCGAGTTTATGGACTAGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025432
VALIDATED
CREBBP MISSION shRNA Bacterial Glycerol Stock
CREB binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-4723s21c1
Sequence:CCGGGAGGATCATTAACGACTATAACTCGAGTTATAGTCGTTAATGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-3952s21c1
Sequence:CCGGCCAACCTCAGACGACAATTTCCTCGAGGAAATTGTCGTCTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-3540s21c1
Sequence:CCGGTCCTAGGAATCCCAGATTATTCTCGAGAATAATCTGGGATTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-930s21c1
Sequence:CCGGCTGGCCATGCTGGACTAAATACTCGAGTATTTAGTCCAGCATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-751s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025432
VALIDATED
CREBBP MISSION shRNA shRNA Plasmid DNA
CREB binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-4723s21c1
Sequence:CCGGGAGGATCATTAACGACTATAACTCGAGTTATAGTCGTTAATGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-3952s21c1
Sequence:CCGGCCAACCTCAGACGACAATTTCCTCGAGGAAATTGTCGTCTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-3540s21c1
Sequence:CCGGTCCTAGGAATCCCAGATTATTCTCGAGAATAATCTGGGATTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-930s21c1
Sequence:CCGGCTGGCCATGCTGGACTAAATACTCGAGTATTTAGTCCAGCATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-751s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025432
VALIDATED
CREBBP MISSION shRNA Lentiviral Transduction Particles
CREB binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-4723s21c1
Sequence:CCGGGAGGATCATTAACGACTATAACTCGAGTTATAGTCGTTAATGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-3952s21c1
Sequence:CCGGCCAACCTCAGACGACAATTTCCTCGAGGAAATTGTCGTCTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-3540s21c1
Sequence:CCGGTCCTAGGAATCCCAGATTATTCTCGAGAATAATCTGGGATTCCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025432.1-930s21c1
Sequence:CCGGCTGGCCATGCTGGACTAAATACTCGAGTATTTAGTCCAGCATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025432.1-751s21c1
Sequence:CCGGTAACTCTGGCCATAGCTTAATCTCGAGATTAAGCTATGGCCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks