EMAIL THIS PAGE TO A FRIEND

CREBL2

cAMP responsive element binding protein-like 2

235 Gene Product Result for
UniProtKB ID: O60519, B5BUM5
Gene ID:
Human(1389) Summary: cAMP response element (CRE)-binding protein-like-2 (CREBL2) was identified in a search to find genes in a commonly deleted region on chromosome 12p13 flanked by ETV6 and CDKN1B genes, frequently associated with hematopoietic malignancies, as well as breast, non-small-cell lung and ovarian cancers. CREBL2 shares a 41% identity with CRE-binding protein (CREB) over a 48-base long region which encodes the bZip domain of CREB. The bZip domain consists of about 30 amino acids rich in basic residues involved in DNA binding, followed by a leucine zipper motif involved in protein dimerization. This suggests that CREBL2 encodes a protein with DNA binding capabilities. The occurance of CREBL2 deletion in malignancy suggests that CREBL2 may act as a tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(232430) cAMP responsive element binding protein-like 2
Rat(362453) cAMP responsive element binding protein-like 2
Zebrafish(436975) cAMP responsive element binding protein-like 2
dog(611207) cAMP responsive element binding protein-like 2
cow(537195) cAMP responsive element binding protein-like 2
domestic cat(101092030) cAMP responsive element binding protein-like 2
chicken(426496) cAMP responsive element binding protein-like 2
sheep(101112213) cAMP responsive element binding protein-like 2
domestic guinea pig(100736119) cAMP responsive element binding protein-like 2
naked mole-rat(101699677) cAMP responsive element binding protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001310 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001310 Rosetta Predictions human pricing
NM_001015027 Rosetta Predictions rat pricing
NM_177687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117578 predicted 787
2 SASI_Hs01_00117579 predicted 798
3 SASI_Hs01_00117580 predicted 772
4 SASI_Hs01_00117581 predicted 802
5 SASI_Hs01_00117582 predicted 943
6 SASI_Hs01_00117583 predicted 1072
7 SASI_Hs01_00117585 predicted 1099
8 SASI_Hs01_00117586 predicted 948
9 SASI_Hs01_00117587 predicted 854
10 SASI_Hs02_00331595 predicted 981
11 SASI_Hs01_00117584 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202123 predicted 634
2 SASI_Rn02_00202124 predicted 1001
3 SASI_Rn02_00202125 predicted 864
4 SASI_Rn02_00202126 predicted 559
5 SASI_Rn02_00202127 predicted 626
6 SASI_Rn02_00202128 predicted 425
7 SASI_Rn02_00202129 predicted 889
8 SASI_Rn02_00202130 predicted 853
9 SASI_Rn02_00202131 predicted 645
10 SASI_Rn02_00202132 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155416 predicted 1066
2 SASI_Mm02_00348018 predicted 981
3 SASI_Mm01_00155417 predicted 340
4 SASI_Mm02_00348019 predicted 1099
5 SASI_Mm01_00155419 predicted 611
6 SASI_Mm01_00155420 predicted 960
7 SASI_Mm01_00155421 predicted 765
8 SASI_Mm01_00155422 predicted 741
9 SASI_Mm01_00155423 predicted 371
10 SASI_Mm01_00155424 predicted 256
11 SASI_Mm01_00155418 predicted 1081
12 SASI_Mm01_00155425 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001310
VALIDATED
CREBL2 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-455s21c1
Sequence:CCGGGAGCTATATGTGCCCTCAGAGCTCGAGCTCTGAGGGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-604s21c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-564s21c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-433s21c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-630s21c1
Sequence:CCGGTTCCTGGTGAAGATTATATAACTCGAGTTATATAATCTTCACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-373s21c1
Sequence:CCGGAGCCGGCAGAGTGCAAGAGAACTCGAGTTCTCTTGCACTCTGCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-3361s1c1
Sequence:CCGGGCTGGCTAATTGACAGTATTTCTCGAGAAATACTGTCAATTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-433s1c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-604s1c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-564s1c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001310.2-303s1c1
Sequence:CCGGCAAAGTAAAGAAGCCCGGTAACTCGAGTTACCGGGCTTCTTTACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001310
VALIDATED
CREBL2 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-455s21c1
Sequence:CCGGGAGCTATATGTGCCCTCAGAGCTCGAGCTCTGAGGGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-604s21c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-564s21c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-433s21c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-630s21c1
Sequence:CCGGTTCCTGGTGAAGATTATATAACTCGAGTTATATAATCTTCACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-373s21c1
Sequence:CCGGAGCCGGCAGAGTGCAAGAGAACTCGAGTTCTCTTGCACTCTGCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-3361s1c1
Sequence:CCGGGCTGGCTAATTGACAGTATTTCTCGAGAAATACTGTCAATTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-433s1c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-604s1c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-564s1c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001310.2-303s1c1
Sequence:CCGGCAAAGTAAAGAAGCCCGGTAACTCGAGTTACCGGGCTTCTTTACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001310
VALIDATED
CREBL2 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-455s21c1
Sequence:CCGGGAGCTATATGTGCCCTCAGAGCTCGAGCTCTGAGGGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-604s21c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-564s21c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-433s21c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-630s21c1
Sequence:CCGGTTCCTGGTGAAGATTATATAACTCGAGTTATATAATCTTCACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001310.2-373s21c1
Sequence:CCGGAGCCGGCAGAGTGCAAGAGAACTCGAGTTCTCTTGCACTCTGCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-3361s1c1
Sequence:CCGGGCTGGCTAATTGACAGTATTTCTCGAGAAATACTGTCAATTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-433s1c1
Sequence:CCGGGAGTTGGTATCCAGTCGAGAACTCGAGTTCTCGACTGGATACCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-604s1c1
Sequence:CCGGGCTGGGAAGACAGATGCTAATCTCGAGATTAGCATCTGTCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001310.2-564s1c1
Sequence:CCGGGCAGAACAAATCTCAGCAGAACTCGAGTTCTGCTGAGATTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001310.2-303s1c1
Sequence:CCGGCAAAGTAAAGAAGCCCGGTAACTCGAGTTACCGGGCTTCTTTACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177687
CREBL2 MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element binding protein-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-485s1c1
Sequence:CCGGCCTTCTGAAATAAGGGCCCTACTCGAGTAGGGCCCTTATTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-429s1c1
Sequence:CCGGGAGAGGAACTGGAAATGTACACTCGAGTGTACATTTCCAGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-407s1c1
Sequence:CCGGGAAAGAGCTATATGTGCACTCCTCGAGGAGTGCACATATAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-259s1c1
Sequence:CCGGCAAAGTGAAGAAGCCTGGTAACTCGAGTTACCAGGCTTCTTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177687.2-1096s1c1
Sequence:CCGGCCTTTCTAGTTACTTGAGTAACTCGAGTTACTCAAGTAACTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-427s1c1
Sequence:CCGGCCGAGAGGAACTGGAAATGTACTCGAGTACATTTCCAGTTCCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-304s1c1
Sequence:CCGGCGACTTGAAAGCGAAACTTGACTCGAGTCAAGTTTCGCTTTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177687
CREBL2 MISSION shRNA shRNA Plasmid DNA
cAMP responsive element binding protein-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-485s1c1
Sequence:CCGGCCTTCTGAAATAAGGGCCCTACTCGAGTAGGGCCCTTATTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-429s1c1
Sequence:CCGGGAGAGGAACTGGAAATGTACACTCGAGTGTACATTTCCAGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-407s1c1
Sequence:CCGGGAAAGAGCTATATGTGCACTCCTCGAGGAGTGCACATATAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-259s1c1
Sequence:CCGGCAAAGTGAAGAAGCCTGGTAACTCGAGTTACCAGGCTTCTTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177687.2-1096s1c1
Sequence:CCGGCCTTTCTAGTTACTTGAGTAACTCGAGTTACTCAAGTAACTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-427s1c1
Sequence:CCGGCCGAGAGGAACTGGAAATGTACTCGAGTACATTTCCAGTTCCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-304s1c1
Sequence:CCGGCGACTTGAAAGCGAAACTTGACTCGAGTCAAGTTTCGCTTTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177687
CREBL2 MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element binding protein-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-485s1c1
Sequence:CCGGCCTTCTGAAATAAGGGCCCTACTCGAGTAGGGCCCTTATTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-429s1c1
Sequence:CCGGGAGAGGAACTGGAAATGTACACTCGAGTGTACATTTCCAGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-407s1c1
Sequence:CCGGGAAAGAGCTATATGTGCACTCCTCGAGGAGTGCACATATAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177687.2-259s1c1
Sequence:CCGGCAAAGTGAAGAAGCCTGGTAACTCGAGTTACCAGGCTTCTTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177687.2-1096s1c1
Sequence:CCGGCCTTTCTAGTTACTTGAGTAACTCGAGTTACTCAAGTAACTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-427s1c1
Sequence:CCGGCCGAGAGGAACTGGAAATGTACTCGAGTACATTTCCAGTTCCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177687.2-304s1c1
Sequence:CCGGCGACTTGAAAGCGAAACTTGACTCGAGTCAAGTTTCGCTTTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks