EMAIL THIS PAGE TO A FRIEND

CREBRF

CREB3 regulatory factor

51 Gene Product Result for
Synonyms: C5orf41 LRF
Gene ID:
Mouse(77128) CREB3 regulatory factor
Rat(303016) CREB3 regulatory factor
naked mole-rat(101703638) CREB3 regulatory factor
domestic guinea pig(100726489) CREB3 regulatory factor
sheep(101108688) CREB3 regulatory factor
Zebrafish(100149876) creb3 regulatory factor
domestic cat(101091424) CREB3 regulatory factor
dog(612888) CREB3 regulatory factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015329 Anti-CREBRF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
AV32239 Anti-LOC153222 antibody produced in rabbit affinity isolated antibody mouse, rabbit, bovine, canine, human, horse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046831 MISSION® esiRNA esiRNA human C5orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153607 Rosetta Predictions human pricing
XM_001064739 Rosetta Predictions rat pricing
XM_220273 Rosetta Predictions rat pricing
NM_029870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240152 predicted 1912
2 SASI_Hs01_00240153 predicted 532
3 SASI_Hs02_00367337 predicted 1981
4 SASI_Hs01_00240154 predicted 1730
5 SASI_Hs01_00240155 predicted 2225
6 SASI_Hs01_00240157 predicted 580
7 SASI_Hs01_00240158 predicted 706
8 SASI_Hs01_00240159 predicted 1790
9 SASI_Hs01_00240160 predicted 936
10 SASI_Hs01_00240161 predicted 2127
11 SASI_Hs01_00240156 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311603 predicted 928
2 SASI_Rn02_00311604 predicted 595
3 SASI_Rn02_00311605 predicted 381
4 SASI_Rn02_00311606 predicted 2276
5 SASI_Rn02_00311607 predicted 1086
6 SASI_Rn02_00311608 predicted 1735
7 SASI_Rn02_00311609 predicted 2238
8 SASI_Rn02_00311610 predicted 1725
9 SASI_Rn02_00311611 predicted 994
10 SASI_Rn02_00311612 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379195 predicted 471
2 SASI_Rn02_00379196 predicted 593
3 SASI_Rn02_00379197 predicted 382
4 SASI_Rn02_00379198 predicted 2275
5 SASI_Rn02_00379199 predicted 1973
6 SASI_Rn02_00379200 predicted 2325
7 SASI_Rn02_00379201 predicted 2238
8 SASI_Rn02_00379202 predicted 417
9 SASI_Rn02_00379203 predicted 2201
10 SASI_Rn02_00379204 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077326 predicted 921
2 SASI_Mm01_00077327 predicted 449
3 SASI_Mm01_00077328 predicted 388
4 SASI_Mm01_00077329 predicted 1678
5 SASI_Mm01_00077330 predicted 1974
6 SASI_Mm02_00336104 predicted 2276
7 SASI_Mm01_00077331 predicted 2239
8 SASI_Mm01_00077332 predicted 547
9 SASI_Mm01_00077333 predicted 960
10 SASI_Mm01_00077334 predicted 2018
11 SASI_Mm01_00077325 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029870
CREBRF MISSION shRNA Bacterial Glycerol Stock
CREB3 regulatory factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029870.1-2541s1c1
Sequence:CCGGGCTGAGTGTTAAGGTGGGTTTCTCGAGAAACCCACCTTAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-413s1c1
Sequence:CCGGCCAACAGTTCTGATCCAGATTCTCGAGAATCTGGATCAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-2816s1c1
Sequence:CCGGGCATACTCTTTGTGCCTTGTACTCGAGTACAAGGCACAAAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-1981s1c1
Sequence:CCGGCTCAACACTGAATATGACAATCTCGAGATTGTCATATTCAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-901s1c1
Sequence:CCGGCCATCATCAGACTGTGTCCAACTCGAGTTGGACACAGTCTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-445s1c1
Sequence:CCGGCTGGATAGAGAGATGAATTATCTCGAGATAATTCATCTCTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-3199s1c1
Sequence:CCGGGCTTACATGATACTGTATGAACTCGAGTTCATACAGTATCATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-594s1c1
Sequence:CCGGCTGTGAAGACTTAACTAAGTACTCGAGTACTTAGTTAAGTCTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-1684s1c1
Sequence:CCGGCGAGATACCTTGCCAAGTAATCTCGAGATTACTTGGCAAGGTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029870
CREBRF MISSION shRNA shRNA Plasmid DNA
CREB3 regulatory factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029870.1-2541s1c1
Sequence:CCGGGCTGAGTGTTAAGGTGGGTTTCTCGAGAAACCCACCTTAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-413s1c1
Sequence:CCGGCCAACAGTTCTGATCCAGATTCTCGAGAATCTGGATCAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-2816s1c1
Sequence:CCGGGCATACTCTTTGTGCCTTGTACTCGAGTACAAGGCACAAAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-1981s1c1
Sequence:CCGGCTCAACACTGAATATGACAATCTCGAGATTGTCATATTCAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-901s1c1
Sequence:CCGGCCATCATCAGACTGTGTCCAACTCGAGTTGGACACAGTCTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-445s1c1
Sequence:CCGGCTGGATAGAGAGATGAATTATCTCGAGATAATTCATCTCTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-3199s1c1
Sequence:CCGGGCTTACATGATACTGTATGAACTCGAGTTCATACAGTATCATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-594s1c1
Sequence:CCGGCTGTGAAGACTTAACTAAGTACTCGAGTACTTAGTTAAGTCTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-1684s1c1
Sequence:CCGGCGAGATACCTTGCCAAGTAATCTCGAGATTACTTGGCAAGGTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029870
CREBRF MISSION shRNA Lentiviral Transduction Particles
CREB3 regulatory factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029870.1-2541s1c1
Sequence:CCGGGCTGAGTGTTAAGGTGGGTTTCTCGAGAAACCCACCTTAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-413s1c1
Sequence:CCGGCCAACAGTTCTGATCCAGATTCTCGAGAATCTGGATCAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-2816s1c1
Sequence:CCGGGCATACTCTTTGTGCCTTGTACTCGAGTACAAGGCACAAAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-1981s1c1
Sequence:CCGGCTCAACACTGAATATGACAATCTCGAGATTGTCATATTCAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-901s1c1
Sequence:CCGGCCATCATCAGACTGTGTCCAACTCGAGTTGGACACAGTCTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029870.1-445s1c1
Sequence:CCGGCTGGATAGAGAGATGAATTATCTCGAGATAATTCATCTCTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029870.1-3199s1c1
Sequence:CCGGGCTTACATGATACTGTATGAACTCGAGTTCATACAGTATCATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-594s1c1
Sequence:CCGGCTGTGAAGACTTAACTAAGTACTCGAGTACTTAGTTAAGTCTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029870.1-1684s1c1
Sequence:CCGGCGAGATACCTTGCCAAGTAATCTCGAGATTACTTGGCAAGGTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153607
VALIDATED
CREBRF MISSION shRNA Bacterial Glycerol Stock
CREB3 regulatory factor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-2120s1c1
Sequence:CCGGGCTGGGCAAACCTCAGAATTTCTCGAGAAATTCTGAGGTTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153607.1-2534s1c1
Sequence:CCGGGCCAAGTATTGTGGCAGATTTCTCGAGAAATCTGCCACAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1672s1c1
Sequence:CCGGCCGAGATACTTTGCCAAGTAACTCGAGTTACTTGGCAAAGTATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-4949s1c1
Sequence:CCGGGCAGCGATACTTGATCTATATCTCGAGATATAGATCAAGTATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1266s1c1
Sequence:CCGGCCAGTACATCAGTCTCAGATTCTCGAGAATCTGAGACTGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-937s21c1
Sequence:CCGGACCCACTTCAAGCACACAAATCTCGAGATTTGTGTGCTTGAAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153607.2-2421s21c1
Sequence:CCGGAGAGCATAAACCATGATTAAACTCGAGTTTAATCATGGTTTATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-1772s21c1
Sequence:CCGGGTAGAAGACCTGACTCCAAATCTCGAGATTTGGAGTCAGGTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-966s21c1
Sequence:CCGGAGACCAACATGTATCATAATGCTCGAGCATTATGATACATGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-727s21c1
Sequence:CCGGTCCAACTTTAGCTCAACTTAACTCGAGTTAAGTTGAGCTAAAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-2091s21c1
Sequence:CCGGAGAAGCTTGAAATCCTCATTACTCGAGTAATGAGGATTTCAAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153607
VALIDATED
CREBRF MISSION shRNA shRNA Plasmid DNA
CREB3 regulatory factor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-2120s1c1
Sequence:CCGGGCTGGGCAAACCTCAGAATTTCTCGAGAAATTCTGAGGTTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153607.1-2534s1c1
Sequence:CCGGGCCAAGTATTGTGGCAGATTTCTCGAGAAATCTGCCACAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1672s1c1
Sequence:CCGGCCGAGATACTTTGCCAAGTAACTCGAGTTACTTGGCAAAGTATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-4949s1c1
Sequence:CCGGGCAGCGATACTTGATCTATATCTCGAGATATAGATCAAGTATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1266s1c1
Sequence:CCGGCCAGTACATCAGTCTCAGATTCTCGAGAATCTGAGACTGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-937s21c1
Sequence:CCGGACCCACTTCAAGCACACAAATCTCGAGATTTGTGTGCTTGAAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153607.2-2421s21c1
Sequence:CCGGAGAGCATAAACCATGATTAAACTCGAGTTTAATCATGGTTTATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-1772s21c1
Sequence:CCGGGTAGAAGACCTGACTCCAAATCTCGAGATTTGGAGTCAGGTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-966s21c1
Sequence:CCGGAGACCAACATGTATCATAATGCTCGAGCATTATGATACATGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-727s21c1
Sequence:CCGGTCCAACTTTAGCTCAACTTAACTCGAGTTAAGTTGAGCTAAAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-2091s21c1
Sequence:CCGGAGAAGCTTGAAATCCTCATTACTCGAGTAATGAGGATTTCAAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153607
VALIDATED
CREBRF MISSION shRNA Lentiviral Transduction Particles
CREB3 regulatory factor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-2120s1c1
Sequence:CCGGGCTGGGCAAACCTCAGAATTTCTCGAGAAATTCTGAGGTTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153607.1-2534s1c1
Sequence:CCGGGCCAAGTATTGTGGCAGATTTCTCGAGAAATCTGCCACAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1672s1c1
Sequence:CCGGCCGAGATACTTTGCCAAGTAACTCGAGTTACTTGGCAAAGTATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-4949s1c1
Sequence:CCGGGCAGCGATACTTGATCTATATCTCGAGATATAGATCAAGTATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153607.1-1266s1c1
Sequence:CCGGCCAGTACATCAGTCTCAGATTCTCGAGAATCTGAGACTGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-937s21c1
Sequence:CCGGACCCACTTCAAGCACACAAATCTCGAGATTTGTGTGCTTGAAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153607.2-2421s21c1
Sequence:CCGGAGAGCATAAACCATGATTAAACTCGAGTTTAATCATGGTTTATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-1772s21c1
Sequence:CCGGGTAGAAGACCTGACTCCAAATCTCGAGATTTGGAGTCAGGTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-966s21c1
Sequence:CCGGAGACCAACATGTATCATAATGCTCGAGCATTATGATACATGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-727s21c1
Sequence:CCGGTCCAACTTTAGCTCAACTTAACTCGAGTTAAGTTGAGCTAAAGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153607.2-2091s21c1
Sequence:CCGGAGAAGCTTGAAATCCTCATTACTCGAGTAATGAGGATTTCAAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks