EMAIL THIS PAGE TO A FRIEND

CREBZF

CREB/ATF bZIP transcription factor

Synonyms: SMILE ZF
UniProtKB ID: Q9NS37, B2R8Q9, Q0P5U9, Q52LT3
Gene ID:
Mouse(233490) CREB/ATF bZIP transcription factor
Rat(293112) CREB/ATF bZIP transcription factor
Zebrafish(562093) CREB/ATF bZIP transcription factor
chicken(772353) CREB/ATF bZIP transcription factor
chicken(101752023) CREB/ATF bZIP transcription factor
cow(538594) CREB/ATF bZIP transcription factor
domestic cat(101083702) CREB/ATF bZIP transcription factor
dog(476783) CREB/ATF bZIP transcription factor
chicken(101665449) CREB/ATF bZIP transcription factor
sheep(101114225) CREB/ATF bZIP transcription factor
domestic guinea pig(100729900) CREB/ATF bZIP transcription factor
226 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039618 Rosetta Predictions human pricing
NM_001106279 Rosetta Predictions rat pricing
NM_145151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133244 predicted 1355
2 SASI_Hs01_00133252 predicted 1436
3 SASI_Hs01_00133245 predicted 1119
4 SASI_Hs01_00133246 predicted 1487
5 SASI_Hs01_00133247 predicted 1312
6 SASI_Hs01_00133248 predicted 1310
7 SASI_Hs01_00133249 predicted 1313
8 SASI_Hs01_00133250 predicted 534
9 SASI_Hs01_00133251 predicted 1384
10 SASI_Hs02_00308608 predicted 250
11 SASI_Hs01_00133253 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217408 predicted 1728
2 SASI_Rn02_00217409 predicted 1563
3 SASI_Rn02_00217410 predicted 1286
4 SASI_Rn02_00217411 predicted 1418
5 SASI_Rn02_00217412 predicted 1578
6 SASI_Rn02_00217413 predicted 1399
7 SASI_Rn02_00217414 predicted 1508
8 SASI_Rn02_00217415 predicted 1650
9 SASI_Rn02_00217416 predicted 1502
10 SASI_Rn02_00217417 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340566 predicted 1496
2 SASI_Mm02_00340567 predicted 1457
3 SASI_Mm02_00340568 predicted 1792
4 SASI_Mm02_00340569 predicted 1796
5 SASI_Mm02_00340570 predicted 1487
6 SASI_Mm02_00340571 predicted 1372
7 SASI_Mm02_00340572 predicted 1310
8 SASI_Mm02_00340573 predicted 1344
9 SASI_Mm02_00340574 predicted 849
10 SASI_Mm02_00340575 predicted 1379
11 SASI_Mm01_00055836 predicted 431
12 SASI_Mm01_00055837 predicted 519
13 SASI_Mm01_00055838 predicted 495
14 SASI_Mm01_00055839 predicted 569
15 SASI_Mm01_00055840 predicted 381
16 SASI_Mm01_00055841 predicted 483
17 SASI_Mm01_00055842 predicted 379
18 SASI_Mm01_00055843 predicted 468
19 SASI_Mm01_00055844 predicted 397
20 SASI_Mm01_00055845 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145151
VALIDATED
CREBZF MISSION shRNA Bacterial Glycerol Stock
CREB/ATF bZIP transcription factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1284s21c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-900s21c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1113s21c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145151.2-1352s21c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-663s1c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-492s1c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145151.1-279s1c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-61s1c1
Sequence:CCGGCTCATAACTCACACACTCATACTCGAGTATGAGTGTGTGAGTTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145151.1-731s1c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145151
VALIDATED
CREBZF MISSION shRNA shRNA Plasmid DNA
CREB/ATF bZIP transcription factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1284s21c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-900s21c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1113s21c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145151.2-1352s21c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-663s1c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-492s1c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145151.1-279s1c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-61s1c1
Sequence:CCGGCTCATAACTCACACACTCATACTCGAGTATGAGTGTGTGAGTTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145151.1-731s1c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145151
VALIDATED
CREBZF MISSION shRNA Lentiviral Transduction Particles
CREB/ATF bZIP transcription factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1284s21c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-900s21c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145151.2-1113s21c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145151.2-1352s21c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-663s1c1
Sequence:CCGGGAAGGCGTCGTCGTCTCTTAACTCGAGTTAAGAGACGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-492s1c1
Sequence:CCGGGCGGCTGACCACCTCCCTCTTCTCGAGAAGAGGGAGGTGGTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145151.1-279s1c1
Sequence:CCGGCCGTCTTAATCGGCTCAAGAACTCGAGTTCTTGAGCCGATTAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145151.1-61s1c1
Sequence:CCGGCTCATAACTCACACACTCATACTCGAGTATGAGTGTGTGAGTTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145151.1-731s1c1
Sequence:CCGGCCTCCCTTACACCATGTCAAACTCGAGTTTGACATGGTGTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039618
CREBZF MISSION shRNA Bacterial Glycerol Stock
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039618.1-2050s21c1
Sequence:CCGGGCACAAATGTGATAGTTATTTCTCGAGAAATAACTATCACATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-1292s21c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-737s21c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-713s21c1
Sequence:CCGGTGCTGAAATGCAGCGCTTCTCCTCGAGGAGAAGCGCTGCATTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-538s21c1
Sequence:CCGGAGACGGAGGATATGGACTTTCCTCGAGGAAAGTCCATATCCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039618
CREBZF MISSION shRNA shRNA Plasmid DNA
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039618.1-2050s21c1
Sequence:CCGGGCACAAATGTGATAGTTATTTCTCGAGAAATAACTATCACATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-1292s21c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-737s21c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-713s21c1
Sequence:CCGGTGCTGAAATGCAGCGCTTCTCCTCGAGGAGAAGCGCTGCATTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-538s21c1
Sequence:CCGGAGACGGAGGATATGGACTTTCCTCGAGGAAAGTCCATATCCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039618
CREBZF MISSION shRNA Lentiviral Transduction Particles
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039618.1-2050s21c1
Sequence:CCGGGCACAAATGTGATAGTTATTTCTCGAGAAATAACTATCACATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-1292s21c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-737s21c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-713s21c1
Sequence:CCGGTGCTGAAATGCAGCGCTTCTCCTCGAGGAGAAGCGCTGCATTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039618.1-538s21c1
Sequence:CCGGAGACGGAGGATATGGACTTTCCTCGAGGAAAGTCCATATCCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021212
VALIDATED
CREBZF MISSION shRNA Bacterial Glycerol Stock
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1249s1c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-494s1c1
Sequence:CCGGGAGACGGAGGATATGGACTTTCTCGAGAAAGTCCATATCCTCCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021212.1-799s1c1
Sequence:CCGGCGGCAGCGGTAACGACAACAACTCGAGTTGTTGTCGTTACCGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-694s1c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1004s1c1
Sequence:CCGGCGCTACCTACGGGCAGTCTTACTCGAGTAAGACTGCCCGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021212
VALIDATED
CREBZF MISSION shRNA shRNA Plasmid DNA
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1249s1c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-494s1c1
Sequence:CCGGGAGACGGAGGATATGGACTTTCTCGAGAAAGTCCATATCCTCCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021212.1-799s1c1
Sequence:CCGGCGGCAGCGGTAACGACAACAACTCGAGTTGTTGTCGTTACCGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-694s1c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1004s1c1
Sequence:CCGGCGCTACCTACGGGCAGTCTTACTCGAGTAAGACTGCCCGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021212
VALIDATED
CREBZF MISSION shRNA Lentiviral Transduction Particles
CREB/ATF bZIP transcription factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1249s1c1
Sequence:CCGGGAAGGCGTCGTCTTCTCTTAACTCGAGTTAAGAGAAGACGACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-494s1c1
Sequence:CCGGGAGACGGAGGATATGGACTTTCTCGAGAAAGTCCATATCCTCCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021212.1-799s1c1
Sequence:CCGGCGGCAGCGGTAACGACAACAACTCGAGTTGTTGTCGTTACCGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-694s1c1
Sequence:CCGGCCTGCTGCAAAGGCTGTTAAACTCGAGTTTAACAGCCTTTGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021212.1-1004s1c1
Sequence:CCGGCGCTACCTACGGGCAGTCTTACTCGAGTAAGACTGCCCGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks