EMAIL THIS PAGE TO A FRIEND

CREG1

cellular repressor of E1A-stimulated genes 1

52 Gene Product Result for
Synonyms: CREG
UniProtKB ID: O75629, B2RDD4, Q8N9A3
Gene ID:
Human(8804) Summary: The adenovirus E1A protein both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. The protein encoded by this gene antagonizes transcriptional activation and cellular transformation by E1A. This protein shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. This gene may contribute to the transcriptional control of cell growth and differentiation. [provided by RefSeq, Jul 2008]
Mouse(433375) cellular repressor of E1A-stimulated genes 1
Rat(289185) cellular repressor of E1A-stimulated genes 1
Zebrafish(791208) cellular repressor of E1A-stimulated genes 1
chicken(768680) cellular repressor of E1A-stimulated genes 1
cow(530908) cellular repressor of E1A-stimulated genes 1
domestic cat(101098599) cellular repressor of E1A-stimulated genes 1
dog(100686738) cellular repressor of E1A-stimulated genes 1
domestic guinea pig(100712823) cellular repressor of E1A-stimulated genes 1
sheep(101114834) cellular repressor of E1A-stimulated genes 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1391 Human CREG ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003851 Rosetta Predictions human pricing
NM_001105966 Rosetta Predictions rat pricing
NM_011804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218029 predicted 1197
2 SASI_Hs01_00218030 predicted 575
3 SASI_Hs01_00218031 predicted 615
4 SASI_Hs01_00218032 predicted 1127
5 SASI_Hs01_00218033 predicted 633
6 SASI_Hs01_00218034 predicted 457
7 SASI_Hs01_00218035 predicted 528
8 SASI_Hs01_00218036 predicted 469
9 SASI_Hs01_00218037 predicted 533
10 SASI_Hs01_00218038 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214302 predicted 573
2 SASI_Rn02_00214303 predicted 567
3 SASI_Rn02_00214304 predicted 481
4 SASI_Rn02_00214305 predicted 479
5 SASI_Rn02_00214306 predicted 539
6 SASI_Rn02_00214307 predicted 622
7 SASI_Rn02_00214308 predicted 515
8 SASI_Rn02_00214309 predicted 1140
9 SASI_Rn02_00214310 predicted 1143
10 SASI_Rn02_00214311 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199995 predicted 393
2 SASI_Mm01_00199996 predicted 361
3 SASI_Mm01_00199997 predicted 440
4 SASI_Mm01_00199998 predicted 589
5 SASI_Mm01_00199999 predicted 268
6 SASI_Mm01_00200000 predicted 600
7 SASI_Mm01_00200002 predicted 458
8 SASI_Mm01_00200003 predicted 486
9 SASI_Mm01_00200004 predicted 368
10 SASI_Mm02_00321486 predicted 595
11 SASI_Mm01_00200001 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003851
VALIDATED
CREG1 MISSION shRNA Bacterial Glycerol Stock
cellular repressor of E1A-stimulated genes 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-1740s1c1
Sequence:CCGGCCCATATACATGATTTCAGAACTCGAGTTCTGAAATCATGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-585s1c1
Sequence:CCGGCCATAATTGGTTCTTTGCTAACTCGAGTTAGCAAAGAACCAATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-632s1c1
Sequence:CCGGTGGACTACTTTGGTGGACCAACTCGAGTTGGTCCACCAAAGTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-503s1c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-548s21c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-899s21c1
Sequence:CCGGCCAATAGAGTTGACCTGTTATCTCGAGATAACAGGTCAACTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-668s21c1
Sequence:CCGGTCTGGGTCCTGGACTACTTTGCTCGAGCAAAGTAGTCCAGGACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-618s21c1
Sequence:CCGGCTGGCCTTCCAGCCATAATTGCTCGAGCAATTATGGCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-573s21c1
Sequence:CCGGTATTGCAAAGCATTCGTTATTCTCGAGAATAACGAATGCTTTGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003851
VALIDATED
CREG1 MISSION shRNA shRNA Plasmid DNA
cellular repressor of E1A-stimulated genes 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-1740s1c1
Sequence:CCGGCCCATATACATGATTTCAGAACTCGAGTTCTGAAATCATGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-585s1c1
Sequence:CCGGCCATAATTGGTTCTTTGCTAACTCGAGTTAGCAAAGAACCAATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-632s1c1
Sequence:CCGGTGGACTACTTTGGTGGACCAACTCGAGTTGGTCCACCAAAGTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-503s1c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-548s21c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-899s21c1
Sequence:CCGGCCAATAGAGTTGACCTGTTATCTCGAGATAACAGGTCAACTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-668s21c1
Sequence:CCGGTCTGGGTCCTGGACTACTTTGCTCGAGCAAAGTAGTCCAGGACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-618s21c1
Sequence:CCGGCTGGCCTTCCAGCCATAATTGCTCGAGCAATTATGGCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-573s21c1
Sequence:CCGGTATTGCAAAGCATTCGTTATTCTCGAGAATAACGAATGCTTTGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003851
VALIDATED
CREG1 MISSION shRNA Lentiviral Transduction Particles
cellular repressor of E1A-stimulated genes 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-1740s1c1
Sequence:CCGGCCCATATACATGATTTCAGAACTCGAGTTCTGAAATCATGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-585s1c1
Sequence:CCGGCCATAATTGGTTCTTTGCTAACTCGAGTTAGCAAAGAACCAATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003851.1-632s1c1
Sequence:CCGGTGGACTACTTTGGTGGACCAACTCGAGTTGGTCCACCAAAGTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003851.1-503s1c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-548s21c1
Sequence:CCGGCCAAGGTGAATGAAACAGAAACTCGAGTTTCTGTTTCATTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-899s21c1
Sequence:CCGGCCAATAGAGTTGACCTGTTATCTCGAGATAACAGGTCAACTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-668s21c1
Sequence:CCGGTCTGGGTCCTGGACTACTTTGCTCGAGCAAAGTAGTCCAGGACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003851.2-618s21c1
Sequence:CCGGCTGGCCTTCCAGCCATAATTGCTCGAGCAATTATGGCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003851.2-573s21c1
Sequence:CCGGTATTGCAAAGCATTCGTTATTCTCGAGAATAACGAATGCTTTGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011804
VALIDATED
CREG1 MISSION shRNA Bacterial Glycerol Stock
cellular repressor of E1A-stimulated genes 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-1649s1c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-621s1c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-504s1c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-396s1c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-261s1c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-504s21c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011804.2-1649s21c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-396s21c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-621s21c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-261s21c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011804
VALIDATED
CREG1 MISSION shRNA shRNA Plasmid DNA
cellular repressor of E1A-stimulated genes 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-1649s1c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-621s1c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-504s1c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-396s1c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-261s1c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-504s21c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011804.2-1649s21c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-396s21c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-621s21c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-261s21c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011804
VALIDATED
CREG1 MISSION shRNA Lentiviral Transduction Particles
cellular repressor of E1A-stimulated genes 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-1649s1c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-621s1c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-504s1c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-396s1c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011804.2-261s1c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-504s21c1
Sequence:CCGGGCAAGGGATTCGCTGTTTGTTCTCGAGAACAAACAGCGAATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011804.2-1649s21c1
Sequence:CCGGCGGCATAGAAACAAACTACAACTCGAGTTGTAGTTTGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-396s21c1
Sequence:CCGGCAGACTGTCTACTGTAGGAATCTCGAGATTCCTACAGTAGACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-621s21c1
Sequence:CCGGCCTAAAGTAGTGACACCTGAACTCGAGTTCAGGTGTCACTACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011804.2-261s21c1
Sequence:CCGGGCGGACATCATCTCAATCAGTCTCGAGACTGATTGAGATGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks