EMAIL THIS PAGE TO A FRIEND

CREG2

cellular repressor of E1A-stimulated genes 2

109 Gene Product Result for
UniProtKB ID: Q8IUH2, Q86X03, Q8N540, Q8N9E3
Gene ID:
Mouse(263764) cellular repressor of E1A-stimulated genes 2
Rat(316353) cellular repressor of E1A-stimulated genes 2
sheep(101110318) cellular repressor of E1A-stimulated genes 2
domestic guinea pig(100723098) cellular repressor of E1A-stimulated genes 2
naked mole-rat(101707080) cellular repressor of E1A-stimulated genes 2
Zebrafish(492339) cellular repressor of E1A-stimulated genes 2
cow(618618) cellular repressor of E1A-stimulated genes 2
domestic cat(101085364) cellular repressor of E1A-stimulated genes 2
dog(611525) cellular repressor of E1A-stimulated genes 2
chicken(770646) cellular repressor of E1A-stimulated genes 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153836 Rosetta Predictions human pricing
XM_001058809 Rosetta Predictions rat pricing
XM_237081 Rosetta Predictions rat pricing
NM_170597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220046 predicted 918
2 SASI_Hs02_00367526 predicted 921
3 SASI_Hs01_00220048 predicted 1061
4 SASI_Hs01_00220049 predicted 938
5 SASI_Hs01_00220050 predicted 1085
6 SASI_Hs01_00220051 predicted 877
7 SASI_Hs01_00220052 predicted 869
8 SASI_Hs02_00367527 predicted 874
9 SASI_Hs02_00367528 predicted 880
10 SASI_Hs01_00220054 predicted 1073
11 SASI_Hs01_00220047 predicted 889
12 SASI_Hs01_00220053 predicted 777
13 SASI_Hs01_00220055 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290942 predicted 1103
2 SASI_Rn02_00290943 predicted 1382
3 SASI_Rn02_00290944 predicted 1050
4 SASI_Rn02_00290945 predicted 1005
5 SASI_Rn02_00290946 predicted 1350
6 SASI_Rn02_00290947 predicted 1113
7 SASI_Rn02_00290948 predicted 533
8 SASI_Rn02_00290949 predicted 1078
9 SASI_Rn02_00290950 predicted 1164
10 SASI_Rn02_00290951 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390647 predicted 410
2 SASI_Rn02_00390648 predicted 345
3 SASI_Rn02_00390649 predicted 219
4 SASI_Rn02_00390650 predicted 413
5 SASI_Rn02_00390651 predicted 255
6 SASI_Rn02_00390652 predicted 2156
7 SASI_Rn02_00390653 predicted 2149
8 SASI_Rn02_00390654 predicted 2183
9 SASI_Rn02_00390655 predicted 252
10 SASI_Rn02_00390656 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049643 predicted 1374
2 SASI_Mm02_00343557 predicted 1448
3 SASI_Mm01_00049644 predicted 1036
4 SASI_Mm01_00049645 predicted 1054
5 SASI_Mm01_00049646 predicted 989
6 SASI_Mm01_00049647 predicted 1453
7 SASI_Mm01_00049648 predicted 1309
8 SASI_Mm01_00049649 predicted 1015
9 SASI_Mm01_00049651 predicted 1014
10 SASI_Mm01_00049652 predicted 1273
11 SASI_Mm01_00049650 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153836
CREG2 MISSION shRNA Bacterial Glycerol Stock
cellular repressor of E1A-stimulated genes 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-541s21c1
Sequence:CCGGCAATAGCACTGGGATTCCTTTCTCGAGAAAGGAATCCCAGTGCTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153836.3-1084s21c1
Sequence:CCGGTGAGATTAAAGTGGTCATTTGCTCGAGCAAATGACCACTTTAATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-663s21c1
Sequence:CCGGACATCGTTGATCCGGAAGATCCTCGAGGATCTTCCGGATCAACGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-570s1c1
Sequence:CCGGCCACAAGAAGATCCAAGGACTCTCGAGAGTCCTTGGATCTTCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-710s1c1
Sequence:CCGGCCTCGCTGATGCTGCCAGAATCTCGAGATTCTGGCAGCATCAGCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-963s1c1
Sequence:CCGGCAGTATTTCAAGGGAGGAATACTCGAGTATTCCTCCCTTGAAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-889s1c1
Sequence:CCGGCGTCAATATGAATGGTTCTTTCTCGAGAAAGAACCATTCATATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1029s1c1
Sequence:CCGGCCTTGGTGTTTGCACTTAAATCTCGAGATTTAAGTGCAAACACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-962s1c1
Sequence:CCGGCCAGTATTTCAAGGGAGGAATCTCGAGATTCCTCCCTTGAAATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1955s1c1
Sequence:CCGGGCACGTCATCATTGGCTCTTACTCGAGTAAGAGCCAATGATGACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153836
CREG2 MISSION shRNA shRNA Plasmid DNA
cellular repressor of E1A-stimulated genes 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-541s21c1
Sequence:CCGGCAATAGCACTGGGATTCCTTTCTCGAGAAAGGAATCCCAGTGCTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153836.3-1084s21c1
Sequence:CCGGTGAGATTAAAGTGGTCATTTGCTCGAGCAAATGACCACTTTAATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-663s21c1
Sequence:CCGGACATCGTTGATCCGGAAGATCCTCGAGGATCTTCCGGATCAACGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-570s1c1
Sequence:CCGGCCACAAGAAGATCCAAGGACTCTCGAGAGTCCTTGGATCTTCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-710s1c1
Sequence:CCGGCCTCGCTGATGCTGCCAGAATCTCGAGATTCTGGCAGCATCAGCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-963s1c1
Sequence:CCGGCAGTATTTCAAGGGAGGAATACTCGAGTATTCCTCCCTTGAAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-889s1c1
Sequence:CCGGCGTCAATATGAATGGTTCTTTCTCGAGAAAGAACCATTCATATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1029s1c1
Sequence:CCGGCCTTGGTGTTTGCACTTAAATCTCGAGATTTAAGTGCAAACACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-962s1c1
Sequence:CCGGCCAGTATTTCAAGGGAGGAATCTCGAGATTCCTCCCTTGAAATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1955s1c1
Sequence:CCGGGCACGTCATCATTGGCTCTTACTCGAGTAAGAGCCAATGATGACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153836
CREG2 MISSION shRNA Lentiviral Transduction Particles
cellular repressor of E1A-stimulated genes 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-541s21c1
Sequence:CCGGCAATAGCACTGGGATTCCTTTCTCGAGAAAGGAATCCCAGTGCTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153836.3-1084s21c1
Sequence:CCGGTGAGATTAAAGTGGTCATTTGCTCGAGCAAATGACCACTTTAATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153836.3-663s21c1
Sequence:CCGGACATCGTTGATCCGGAAGATCCTCGAGGATCTTCCGGATCAACGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-570s1c1
Sequence:CCGGCCACAAGAAGATCCAAGGACTCTCGAGAGTCCTTGGATCTTCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-710s1c1
Sequence:CCGGCCTCGCTGATGCTGCCAGAATCTCGAGATTCTGGCAGCATCAGCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153836.1-963s1c1
Sequence:CCGGCAGTATTTCAAGGGAGGAATACTCGAGTATTCCTCCCTTGAAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-889s1c1
Sequence:CCGGCGTCAATATGAATGGTTCTTTCTCGAGAAAGAACCATTCATATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1029s1c1
Sequence:CCGGCCTTGGTGTTTGCACTTAAATCTCGAGATTTAAGTGCAAACACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153836.1-962s1c1
Sequence:CCGGCCAGTATTTCAAGGGAGGAATCTCGAGATTCCTCCCTTGAAATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153836.1-1955s1c1
Sequence:CCGGGCACGTCATCATTGGCTCTTACTCGAGTAAGAGCCAATGATGACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170597
CREG2 MISSION shRNA Bacterial Glycerol Stock
cellular repressor of E1A-stimulated genes 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170597.3-1447s1c1
Sequence:CCGGCGCCTGTATGTAGCATGTTATCTCGAGATAACATGCTACATACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-1074s1c1
Sequence:CCGGGAGGAATACTTCAAGGCAGCTCTCGAGAGCTGCCTTGAAGTATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-725s1c1
Sequence:CCGGCGTCCACAACAGCACAGGGATCTCGAGATCCCTGTGCTGTTGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-986s1c1
Sequence:CCGGCCGACAGTATGAATGGTTCTTCTCGAGAAGAACCATTCATACTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170597
CREG2 MISSION shRNA shRNA Plasmid DNA
cellular repressor of E1A-stimulated genes 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170597.3-1447s1c1
Sequence:CCGGCGCCTGTATGTAGCATGTTATCTCGAGATAACATGCTACATACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-1074s1c1
Sequence:CCGGGAGGAATACTTCAAGGCAGCTCTCGAGAGCTGCCTTGAAGTATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-725s1c1
Sequence:CCGGCGTCCACAACAGCACAGGGATCTCGAGATCCCTGTGCTGTTGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-986s1c1
Sequence:CCGGCCGACAGTATGAATGGTTCTTCTCGAGAAGAACCATTCATACTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170597
CREG2 MISSION shRNA Lentiviral Transduction Particles
cellular repressor of E1A-stimulated genes 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170597.3-1447s1c1
Sequence:CCGGCGCCTGTATGTAGCATGTTATCTCGAGATAACATGCTACATACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-1074s1c1
Sequence:CCGGGAGGAATACTTCAAGGCAGCTCTCGAGAGCTGCCTTGAAGTATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-725s1c1
Sequence:CCGGCGTCCACAACAGCACAGGGATCTCGAGATCCCTGTGCTGTTGTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170597.3-986s1c1
Sequence:CCGGCCGACAGTATGAATGGTTCTTCTCGAGAAGAACCATTCATACTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)