EMAIL THIS PAGE TO A FRIEND

CRELD1

cysteine-rich with EGF-like domains 1

142 Gene Product Result for
Synonyms: AVSD2 CIRRIN
UniProtKB ID: Q96HD1, A8MX90, B2RAA9, Q6I9X5, Q8NFT4, Q9Y409
Gene ID:
Human(78987) Summary: This gene encodes a member of a subfamily of epidermal growth factor-related proteins. The encoded protein is characterized by a cysteine-rich with epidermal growth factor-like domain. This protein may function as a cell adhesion molecule. Mutations in this gene are the cause of atrioventricular septal defect. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Mouse(171508) cysteine-rich with EGF-like domains 1
Rat(312638) cysteine-rich with EGF-like domains 1
dog(610107) cysteine-rich with EGF-like domains 1
cow(504854) cysteine-rich with EGF-like domains 1
Horse(100051995) cysteine-rich with EGF-like domains 1
domestic cat(101085107) cysteine-rich with EGF-like domains 1
naked mole-rat(101702933) cysteine-rich with EGF-like domains 1
domestic guinea pig(100718367) cysteine-rich with EGF-like domains 1
sheep(101102184) cysteine-rich with EGF-like domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV45004 Anti-CRELD1 antibody produced in rabbit IgG fraction of antiserum canine, human, bovine, mouse, horse, rat, guinea pig
immunohistochemistry, western blot pricing
HPA026964 Anti-CRELD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1412885 Anti-CRELD1 antibody produced in rabbit purified immunoglobulin, 1 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031717 Rosetta Predictions human pricing
NM_001077415 Rosetta Predictions human pricing
NM_015513 Rosetta Predictions human pricing
NM_001024783 Rosetta Predictions rat pricing
NM_133930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214018 predicted 826
2 SASI_Hs01_00214019 predicted 1798
3 SASI_Hs01_00214020 predicted 401
4 SASI_Hs01_00214021 predicted 833
5 SASI_Hs01_00214022 predicted 886
6 SASI_Hs01_00214023 predicted 608
7 SASI_Hs01_00214024 predicted 787
8 SASI_Hs01_00214025 predicted 871
9 SASI_Hs01_00214026 predicted 373
10 SASI_Hs01_00214027 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312494 predicted 833
2 SASI_Hs02_00312495 predicted 1604
3 SASI_Hs02_00312496 predicted 403
4 SASI_Hs02_00312497 predicted 836
5 SASI_Hs02_00312498 predicted 881
6 SASI_Hs02_00312499 predicted 607
7 SASI_Hs02_00312500 predicted 783
8 SASI_Hs02_00312501 predicted 873
9 SASI_Hs02_00312502 predicted 367
10 SASI_Hs02_00312503 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198219 predicted 1330
2 SASI_Hs01_00198220 predicted 2105
3 SASI_Hs01_00198221 predicted 894
4 SASI_Hs01_00198222 predicted 1327
5 SASI_Hs01_00198223 predicted 1384
6 SASI_Hs01_00198224 predicted 1105
7 SASI_Hs01_00198225 predicted 1286
8 SASI_Hs01_00198226 predicted 1374
9 SASI_Hs01_00198227 predicted 864
10 SASI_Hs01_00198228 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202677 predicted 400
2 SASI_Rn01_00076429 predicted 1417
3 SASI_Rn02_00202678 predicted 1119
4 SASI_Rn01_00076430 predicted 1367
5 SASI_Rn01_00076431 predicted 1273
6 SASI_Rn01_00076432 predicted 974
7 SASI_Rn01_00076435 predicted 1235
8 SASI_Rn01_00076436 predicted 795
9 SASI_Rn01_00076437 predicted 1515
10 SASI_Rn01_00076438 predicted 1351
11 SASI_Rn01_00076433 predicted 405
12 SASI_Rn01_00076434 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053950 predicted 946
2 SASI_Mm01_00053951 predicted 822
3 SASI_Mm01_00053952 predicted 1524
4 SASI_Mm01_00053953 predicted 1099
5 SASI_Mm01_00053954 predicted 1463
6 SASI_Mm01_00053955 predicted 1574
7 SASI_Mm01_00053956 predicted 942
8 SASI_Mm01_00053957 predicted 1664
9 SASI_Mm01_00053958 predicted 1636
10 SASI_Mm01_00053959 predicted 1675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133930
VALIDATED
CRELD1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich with EGF-like domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1645s1c1
Sequence:CCGGAGGTTATTTCTCTCTCCCTATCTCGAGATAGGGAGAGAGAAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1046s1c1
Sequence:CCGGCTGCATCACCTCAAGTGTGTACTCGAGTACACACTTGAGGTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1489s1c1
Sequence:CCGGTGACTTGGTGTTCACTGCCATCTCGAGATGGCAGTGAACACCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-566s1c1
Sequence:CCGGGAGAAGTTGTCCAAATACAAACTCGAGTTTGTATTTGGACAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-958s1c1
Sequence:CCGGTCTGGTATGTTCGGCGTGTTTCTCGAGAAACACGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133930
VALIDATED
CRELD1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich with EGF-like domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1645s1c1
Sequence:CCGGAGGTTATTTCTCTCTCCCTATCTCGAGATAGGGAGAGAGAAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1046s1c1
Sequence:CCGGCTGCATCACCTCAAGTGTGTACTCGAGTACACACTTGAGGTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1489s1c1
Sequence:CCGGTGACTTGGTGTTCACTGCCATCTCGAGATGGCAGTGAACACCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-566s1c1
Sequence:CCGGGAGAAGTTGTCCAAATACAAACTCGAGTTTGTATTTGGACAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-958s1c1
Sequence:CCGGTCTGGTATGTTCGGCGTGTTTCTCGAGAAACACGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133930
VALIDATED
CRELD1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich with EGF-like domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1645s1c1
Sequence:CCGGAGGTTATTTCTCTCTCCCTATCTCGAGATAGGGAGAGAGAAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1046s1c1
Sequence:CCGGCTGCATCACCTCAAGTGTGTACTCGAGTACACACTTGAGGTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-1489s1c1
Sequence:CCGGTGACTTGGTGTTCACTGCCATCTCGAGATGGCAGTGAACACCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-566s1c1
Sequence:CCGGGAGAAGTTGTCCAAATACAAACTCGAGTTTGTATTTGGACAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133930.1-958s1c1
Sequence:CCGGTCTGGTATGTTCGGCGTGTTTCTCGAGAAACACGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015513
CRELD1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich with EGF-like domains 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1461s1c1
Sequence:CCGGGCAGATGTTCTTTGGCATCATCTCGAGATGATGCCAAAGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-984s1c1
Sequence:CCGGTCTGGTATGTTCGGCTTGTTTCTCGAGAAACAAGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1413s1c1
Sequence:CCGGAGCAGGCTTCTTCTCAGAGATCTCGAGATCTCTGAGAAGAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-587s1c1
Sequence:CCGGAGGAAGAGAATTTGTCCAAATCTCGAGATTTGGACAAATTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1131s1c1
Sequence:CCGGAGCTGACCAATTCTGCGTGAACTCGAGTTCACGCAGAATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1281s21c1
Sequence:CCGGTCAGGACCTGAGGAATCAAACCTCGAGGTTTGATTCCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1198s21c1
Sequence:CCGGAGTGTGGCCTTGGCTACTTTGCTCGAGCAAAGTAGCCAAGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1336s21c1
Sequence:CCGGACCTCAAGTGTGTAGACATTGCTCGAGCAATGTCTACACACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015513
CRELD1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich with EGF-like domains 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1461s1c1
Sequence:CCGGGCAGATGTTCTTTGGCATCATCTCGAGATGATGCCAAAGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-984s1c1
Sequence:CCGGTCTGGTATGTTCGGCTTGTTTCTCGAGAAACAAGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1413s1c1
Sequence:CCGGAGCAGGCTTCTTCTCAGAGATCTCGAGATCTCTGAGAAGAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-587s1c1
Sequence:CCGGAGGAAGAGAATTTGTCCAAATCTCGAGATTTGGACAAATTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1131s1c1
Sequence:CCGGAGCTGACCAATTCTGCGTGAACTCGAGTTCACGCAGAATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1281s21c1
Sequence:CCGGTCAGGACCTGAGGAATCAAACCTCGAGGTTTGATTCCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1198s21c1
Sequence:CCGGAGTGTGGCCTTGGCTACTTTGCTCGAGCAAAGTAGCCAAGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1336s21c1
Sequence:CCGGACCTCAAGTGTGTAGACATTGCTCGAGCAATGTCTACACACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015513
CRELD1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich with EGF-like domains 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1461s1c1
Sequence:CCGGGCAGATGTTCTTTGGCATCATCTCGAGATGATGCCAAAGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-984s1c1
Sequence:CCGGTCTGGTATGTTCGGCTTGTTTCTCGAGAAACAAGCCGAACATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1413s1c1
Sequence:CCGGAGCAGGCTTCTTCTCAGAGATCTCGAGATCTCTGAGAAGAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-587s1c1
Sequence:CCGGAGGAAGAGAATTTGTCCAAATCTCGAGATTTGGACAAATTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015513.2-1131s1c1
Sequence:CCGGAGCTGACCAATTCTGCGTGAACTCGAGTTCACGCAGAATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1281s21c1
Sequence:CCGGTCAGGACCTGAGGAATCAAACCTCGAGGTTTGATTCCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1198s21c1
Sequence:CCGGAGTGTGGCCTTGGCTACTTTGCTCGAGCAAAGTAGCCAAGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015513.3-1336s21c1
Sequence:CCGGACCTCAAGTGTGTAGACATTGCTCGAGCAATGTCTACACACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks