EMAIL THIS PAGE TO A FRIEND

CRELD2

cysteine-rich with EGF-like domains 2

48 Gene Product Result for
Gene ID:
Mouse(76737) cysteine-rich with EGF-like domains 2
Rat(362978) cysteine-rich with EGF-like domains 2
sheep(101113143) cysteine-rich with EGF-like domains 2
domestic guinea pig(100726881) cysteine-rich with EGF-like domains 2
naked mole-rat(101714608) cysteine-rich with EGF-like domains 2
Zebrafish(393495) cysteine-rich with EGF-like domains 2
chicken(417735) cysteine-rich with EGF-like domains 2
dog(100686873) cysteine-rich with EGF-like domains 2
domestic cat(101099815) cysteine-rich with EGF-like domains 2
cow(515222) cysteine-rich with EGF-like domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024324 Rosetta Predictions human pricing
NM_001037208 Rosetta Predictions rat pricing
NM_029720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027506 predicted 403
2 SASI_Hs01_00027508 predicted 698
3 SASI_Hs01_00027509 predicted 881
4 SASI_Hs01_00027510 predicted 1121
5 SASI_Hs01_00027511 predicted 402
6 SASI_Hs01_00027512 predicted 327
7 SASI_Hs02_00356671 predicted 337
8 SASI_Hs01_00027513 predicted 634
9 SASI_Hs01_00027514 predicted 318
10 SASI_Hs01_00027515 predicted 261
11 SASI_Hs01_00027507 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111836 predicted 786
2 SASI_Rn01_00111838 predicted 933
3 SASI_Rn01_00111839 predicted 664
4 SASI_Rn01_00111840 predicted 473
5 SASI_Rn02_00204322 predicted 245
6 SASI_Rn01_00111842 predicted 468
7 SASI_Rn01_00111843 predicted 661
8 SASI_Rn01_00111844 predicted 862
9 SASI_Rn02_00204323 predicted 1101
10 SASI_Rn01_00111845 predicted 928
11 SASI_Rn01_00111837 predicted 1023
12 SASI_Rn01_00111841 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137054 predicted 881
2 SASI_Mm01_00137055 predicted 264
3 SASI_Mm02_00335800 predicted 298
4 SASI_Mm01_00137056 predicted 1120
5 SASI_Mm01_00137057 predicted 647
6 SASI_Mm01_00137058 predicted 798
7 SASI_Mm01_00137059 predicted 443
8 SASI_Mm01_00137060 predicted 684
9 SASI_Mm01_00137061 predicted 566
10 SASI_Mm01_00137063 predicted 620
11 SASI_Mm01_00137062 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024324
VALIDATED
CRELD2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich with EGF-like domains 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1092s21c1
Sequence:CCGGTCCTGACGGCTTCGAAGAAACCTCGAGGTTTCTTCGAAGCCGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1199s21c1
Sequence:CCGGGTGCCGGACTTACCCTTTAAACTCGAGTTTAAAGGGTAAGTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1225s21c1
Sequence:CCGGCAGAAGGATGTCCCGTGGAAACTCGAGTTTCCACGGGACATCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-398s1c1
Sequence:CCGGGAAGAGCGAATATCCTGACTTCTCGAGAAGTCAGGATATTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-997s1c1
Sequence:CCGGGCTACAATACTCCAGGGAGCTCTCGAGAGCTCCCTGGAGTATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-411s1c1
Sequence:CCGGCCTGACTTATTCGAGTGGTTTCTCGAGAAACCACTCGAATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-332s1c1
Sequence:CCGGCGACTTCGAATGCAACCAGATCTCGAGATCTGGTTGCATTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-887s1c1
Sequence:CCGGAGGAAACTGTAAAGAGTGTATCTCGAGATACACTCTTTACAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024324
VALIDATED
CRELD2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich with EGF-like domains 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1092s21c1
Sequence:CCGGTCCTGACGGCTTCGAAGAAACCTCGAGGTTTCTTCGAAGCCGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1199s21c1
Sequence:CCGGGTGCCGGACTTACCCTTTAAACTCGAGTTTAAAGGGTAAGTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1225s21c1
Sequence:CCGGCAGAAGGATGTCCCGTGGAAACTCGAGTTTCCACGGGACATCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-398s1c1
Sequence:CCGGGAAGAGCGAATATCCTGACTTCTCGAGAAGTCAGGATATTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-997s1c1
Sequence:CCGGGCTACAATACTCCAGGGAGCTCTCGAGAGCTCCCTGGAGTATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-411s1c1
Sequence:CCGGCCTGACTTATTCGAGTGGTTTCTCGAGAAACCACTCGAATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-332s1c1
Sequence:CCGGCGACTTCGAATGCAACCAGATCTCGAGATCTGGTTGCATTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-887s1c1
Sequence:CCGGAGGAAACTGTAAAGAGTGTATCTCGAGATACACTCTTTACAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024324
VALIDATED
CRELD2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich with EGF-like domains 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1092s21c1
Sequence:CCGGTCCTGACGGCTTCGAAGAAACCTCGAGGTTTCTTCGAAGCCGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1199s21c1
Sequence:CCGGGTGCCGGACTTACCCTTTAAACTCGAGTTTAAAGGGTAAGTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024324.3-1225s21c1
Sequence:CCGGCAGAAGGATGTCCCGTGGAAACTCGAGTTTCCACGGGACATCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-398s1c1
Sequence:CCGGGAAGAGCGAATATCCTGACTTCTCGAGAAGTCAGGATATTCGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-997s1c1
Sequence:CCGGGCTACAATACTCCAGGGAGCTCTCGAGAGCTCCCTGGAGTATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-411s1c1
Sequence:CCGGCCTGACTTATTCGAGTGGTTTCTCGAGAAACCACTCGAATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-332s1c1
Sequence:CCGGCGACTTCGAATGCAACCAGATCTCGAGATCTGGTTGCATTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024324.2-887s1c1
Sequence:CCGGAGGAAACTGTAAAGAGTGTATCTCGAGATACACTCTTTACAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029720
VALIDATED
CRELD2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich with EGF-like domains 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-249s21c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-928s21c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-398s21c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-1136s21c1
Sequence:CCGGGAAGCCAAACTCACCCTTTAACTCGAGTTAAAGGGTGAGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029720.1-1151s1c1
Sequence:CCGGCCTTTAAGTTATTGAGAGGATCTCGAGATCCTCTCAATAACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-250s1c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-929s1c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-399s1c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-403s1c1
Sequence:CCGGCCTATTTGAGTGGTTCTGTGTCTCGAGACACAGAACCACTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029720
VALIDATED
CRELD2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich with EGF-like domains 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-249s21c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-928s21c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-398s21c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-1136s21c1
Sequence:CCGGGAAGCCAAACTCACCCTTTAACTCGAGTTAAAGGGTGAGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029720.1-1151s1c1
Sequence:CCGGCCTTTAAGTTATTGAGAGGATCTCGAGATCCTCTCAATAACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-250s1c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-929s1c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-399s1c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-403s1c1
Sequence:CCGGCCTATTTGAGTGGTTCTGTGTCTCGAGACACAGAACCACTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029720
VALIDATED
CRELD2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich with EGF-like domains 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-249s21c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-928s21c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-398s21c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029720.2-1136s21c1
Sequence:CCGGGAAGCCAAACTCACCCTTTAACTCGAGTTAAAGGGTGAGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029720.1-1151s1c1
Sequence:CCGGCCTTTAAGTTATTGAGAGGATCTCGAGATCCTCTCAATAACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-250s1c1
Sequence:CCGGGACGCTGTCTAAGTACGAATTCTCGAGAATTCGTACTTAGACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-929s1c1
Sequence:CCGGGATATAGATGAATGCTCACTACTCGAGTAGTGAGCATTCATCTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-399s1c1
Sequence:CCGGCCAACCTATTTGAGTGGTTCTCTCGAGAGAACCACTCAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029720.1-403s1c1
Sequence:CCGGCCTATTTGAGTGGTTCTGTGTCTCGAGACACAGAACCACTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks