EMAIL THIS PAGE TO A FRIEND

CREM

cAMP responsive element modulator

514 Gene Product Result for
Synonyms: CREM-2 ICER hCREM-2
Gene ID:
Human(1390) Summary: This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]
Mouse(12916) cAMP responsive element modulator
Rat(25620) cAMP responsive element modulator
chicken(378903) cAMP responsive element modulator
dog(403887) cAMP responsive element modulator
cow(540605) cAMP responsive element modulator
domestic cat(101094681) cAMP responsive element modulator
Horse(100054937) cAMP responsive element modulator
naked mole-rat(101700499) cAMP responsive element modulator
domestic guinea pig(100720701) cAMP responsive element modulator
Goat(100861259) cAMP responsive element modulator
sheep(100125358) cAMP responsive element modulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125161 MISSION® esiRNA esiRNA human CREM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001881 Rosetta Predictions human pricing
NM_181571 Rosetta Predictions human pricing
NM_182717 Rosetta Predictions human pricing
NM_182718 Rosetta Predictions human pricing
NM_182719 Rosetta Predictions human pricing
NM_182720 Rosetta Predictions human pricing
NM_182721 Rosetta Predictions human pricing
NM_182722 Rosetta Predictions human pricing
NM_182723 Rosetta Predictions human pricing
NM_182724 Rosetta Predictions human pricing
NM_182725 Rosetta Predictions human pricing
NM_182769 Rosetta Predictions human pricing
NM_182770 Rosetta Predictions human pricing
NM_182771 Rosetta Predictions human pricing
NM_182772 Rosetta Predictions human pricing
NM_182850 Rosetta Predictions human pricing
NM_182853 Rosetta Predictions human pricing
NM_183011 Rosetta Predictions human pricing
NM_183012 Rosetta Predictions human pricing
NM_183013 Rosetta Predictions human pricing
NM_183060 Rosetta Predictions human pricing
NM_001110860 Rosetta Predictions rat pricing
NM_013086 Rosetta Predictions rat pricing
NM_017334 Rosetta Predictions rat pricing
NM_001110850 Rosetta Predictions mouse pricing
NM_001110851 Rosetta Predictions mouse pricing
NM_001110852 Rosetta Predictions mouse pricing
NM_001110853 Rosetta Predictions mouse pricing
NM_001110854 Rosetta Predictions mouse pricing
NM_001110855 Rosetta Predictions mouse pricing
NM_001110856 Rosetta Predictions mouse pricing
NM_001110857 Rosetta Predictions mouse pricing
NM_001110858 Rosetta Predictions mouse pricing
NM_001110859 Rosetta Predictions mouse pricing
NM_013498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111488 predicted 358
2 SASI_Hs01_00111489 predicted 605
3 SASI_Hs01_00111490 predicted 640
4 SASI_Hs02_00332732 predicted 518
5 SASI_Hs02_00332733 predicted 785
6 SASI_Hs01_00111492 predicted 621
7 SASI_Hs01_00111493 predicted 673
8 SASI_Hs01_00111494 predicted 754
9 SASI_Hs01_00111495 predicted 445
10 SASI_Hs01_00111496 predicted 548
11 SASI_Hs01_00111491 predicted 491
12 SASI_Hs01_00111497 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020080 predicted 1213
2 SASI_Hs01_00020072 predicted 1324
3 SASI_Hs01_00020073 predicted 1123
4 SASI_Hs01_00020074 predicted 1124
5 SASI_Hs01_00020075 predicted 1309
6 SASI_Hs01_00020076 predicted 1197
7 SASI_Hs01_00020077 predicted 1319
8 SASI_Hs01_00020078 predicted 1165
9 SASI_Hs01_00020079 predicted 1161
10 SASI_Hs02_00370179 predicted 1014
11 SASI_Hs01_00020081 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232497 predicted 890
2 SASI_Hs01_00232498 predicted 889
3 SASI_Hs01_00232499 predicted 520
4 SASI_Hs01_00232500 predicted 246
5 SASI_Hs01_00232501 predicted 584
6 SASI_Hs01_00232502 predicted 594
7 SASI_Hs01_00232503 predicted 415
8 SASI_Hs02_00370882 predicted 545
9 SASI_Hs01_00232504 predicted 609
10 SASI_Hs02_00370883 predicted 691
11 SASI_Hs01_00232505 predicted 405
12 SASI_Hs01_00232506 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206760 predicted 542
2 SASI_Hs01_00206752 predicted 658
3 SASI_Hs01_00206753 predicted 451
4 SASI_Hs01_00206754 predicted 452
5 SASI_Hs01_00206755 predicted 638
6 SASI_Hs01_00206756 predicted 532
7 SASI_Hs01_00206757 predicted 652
8 SASI_Hs01_00206758 predicted 497
9 SASI_Hs01_00206759 predicted 487
10 SASI_Hs01_00206761 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142858 predicted 574
2 SASI_Hs01_00142850 predicted 694
3 SASI_Hs01_00142851 predicted 494
4 SASI_Hs01_00142852 predicted 488
5 SASI_Hs01_00142853 predicted 672
6 SASI_Hs01_00142854 predicted 560
7 SASI_Hs01_00142855 predicted 691
8 SASI_Hs01_00142856 predicted 528
9 SASI_Hs01_00142857 predicted 522
10 SASI_Hs01_00142859 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232102 predicted 860
2 SASI_Hs01_00232103 predicted 853
3 SASI_Hs01_00232104 predicted 491
4 SASI_Hs01_00232105 predicted 741
5 SASI_Hs01_00232106 predicted 214
6 SASI_Hs01_00232107 predicted 540
7 SASI_Hs01_00232108 predicted 564
8 SASI_Hs01_00232109 predicted 370
9 SASI_Hs02_00370884 predicted 63
10 SASI_Hs01_00232110 predicted 784
11 SASI_Hs01_00232111 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083840 predicted 969
2 SASI_Hs01_00083841 predicted 969
3 SASI_Hs01_00083842 predicted 602
4 SASI_Hs01_00083843 predicted 167
5 SASI_Hs01_00083844 predicted 325
6 SASI_Hs01_00083845 predicted 649
7 SASI_Hs01_00083846 predicted 666
8 SASI_Hs01_00083847 predicted 491
9 SASI_Hs02_00370885 predicted 613
10 SASI_Hs01_00083848 predicted 680
11 SASI_Hs01_00083849 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176310 predicted 1011
2 SASI_Hs01_00176311 predicted 1010
3 SASI_Hs01_00176312 predicted 636
4 SASI_Hs01_00176313 predicted 895
5 SASI_Hs01_00176314 predicted 366
6 SASI_Hs01_00176315 predicted 693
7 SASI_Hs01_00176316 predicted 712
8 SASI_Hs01_00176317 predicted 517
9 SASI_Hs01_00176318 predicted 931
10 SASI_Hs01_00176319 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131477 predicted 1044
2 SASI_Hs01_00131478 predicted 1051
3 SASI_Hs01_00131479 predicted 681
4 SASI_Hs01_00131480 predicted 930
5 SASI_Hs01_00131481 predicted 404
6 SASI_Hs01_00131482 predicted 733
7 SASI_Hs01_00131483 predicted 749
8 SASI_Hs01_00131484 predicted 555
9 SASI_Hs01_00131485 predicted 966
10 SASI_Hs01_00131486 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204966 predicted 656
2 SASI_Hs01_00204958 predicted 766
3 SASI_Hs01_00204959 predicted 567
4 SASI_Hs01_00204960 predicted 569
5 SASI_Hs01_00204961 predicted 752
6 SASI_Hs01_00204962 predicted 639
7 SASI_Hs01_00204963 predicted 759
8 SASI_Hs01_00204964 predicted 607
9 SASI_Hs01_00204965 predicted 599
10 SASI_Hs01_00204967 predicted 172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059872 predicted 696
2 SASI_Hs01_00059864 predicted 811
3 SASI_Hs01_00059865 predicted 605
4 SASI_Hs01_00059866 predicted 613
5 SASI_Hs01_00059867 predicted 787
6 SASI_Hs01_00059868 predicted 684
7 SASI_Hs01_00059869 predicted 807
8 SASI_Hs01_00059870 predicted 651
9 SASI_Hs01_00059871 predicted 646
10 SASI_Hs01_00059873 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033710 predicted 996
2 SASI_Hs01_00033702 predicted 1110
3 SASI_Hs01_00033703 predicted 911
4 SASI_Hs01_00033704 predicted 906
5 SASI_Hs01_00033705 predicted 1094
6 SASI_Hs01_00033706 predicted 985
7 SASI_Hs01_00033707 predicted 1102
8 SASI_Hs01_00033708 predicted 950
9 SASI_Hs01_00033709 predicted 943
10 SASI_Hs02_00370937 predicted 797
11 SASI_Hs01_00033711 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022062 predicted 803
2 SASI_Hs01_00022054 predicted 917
3 SASI_Hs01_00022055 predicted 720
4 SASI_Hs01_00022056 predicted 721
5 SASI_Hs01_00022057 predicted 901
6 SASI_Hs01_00022058 predicted 792
7 SASI_Hs01_00022059 predicted 917
8 SASI_Hs01_00022060 predicted 756
9 SASI_Hs01_00022061 predicted 756
10 SASI_Hs01_00022063 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071201 predicted 1148
2 SASI_Hs01_00071193 predicted 1260
3 SASI_Hs01_00071194 predicted 1059
4 SASI_Hs01_00071195 predicted 1063
5 SASI_Hs01_00071196 predicted 1246
6 SASI_Hs01_00071197 predicted 1132
7 SASI_Hs01_00071198 predicted 1257
8 SASI_Hs01_00071199 predicted 1102
9 SASI_Hs01_00071200 predicted 1102
10 SASI_Hs01_00071202 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072758 predicted 964
2 SASI_Hs01_00072750 predicted 1074
3 SASI_Hs01_00072751 predicted 868
4 SASI_Hs01_00072752 predicted 869
5 SASI_Hs01_00072753 predicted 1056
6 SASI_Hs01_00072754 predicted 945
7 SASI_Hs01_00072755 predicted 1074
8 SASI_Hs01_00072756 predicted 907
9 SASI_Hs01_00072757 predicted 913
10 SASI_Hs02_00370938 predicted 762
11 SASI_Hs01_00072759 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142789 predicted 779
2 SASI_Hs01_00142781 predicted 891
3 SASI_Hs01_00142782 predicted 687
4 SASI_Hs01_00142783 predicted 686
5 SASI_Hs01_00142784 predicted 876
6 SASI_Hs01_00142785 predicted 758
7 SASI_Hs01_00142786 predicted 889
8 SASI_Hs01_00142787 predicted 731
9 SASI_Hs01_00142788 predicted 721
10 SASI_Hs01_00142790 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173496 predicted 1088
2 SASI_Hs01_00173497 predicted 1088
3 SASI_Hs01_00173498 predicted 716
4 SASI_Hs01_00173499 predicted 975
5 SASI_Hs01_00173500 predicted 440
6 SASI_Hs01_00173501 predicted 773
7 SASI_Hs01_00173502 predicted 795
8 SASI_Hs01_00173503 predicted 606
9 SASI_Hs01_00173504 predicted 1015
10 SASI_Hs01_00173505 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243799 predicted 1424
2 SASI_Hs01_00243800 predicted 1419
3 SASI_Hs01_00243801 predicted 770
4 SASI_Hs01_00243802 predicted 942
5 SASI_Hs01_00243803 predicted 132
6 SASI_Hs01_00243804 predicted 390
7 SASI_Hs01_00243805 predicted 933
8 SASI_Hs01_00243806 predicted 420
9 SASI_Hs02_00371180 predicted 294
10 SASI_Hs01_00243807 predicted 403
11 SASI_Hs01_00243808 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234796 predicted 1229
2 SASI_Hs01_00234797 predicted 1228
3 SASI_Hs01_00234798 predicted 582
4 SASI_Hs01_00234799 predicted 752
5 SASI_Hs01_00234800 predicted 132
6 SASI_Hs01_00234801 predicted 388
7 SASI_Hs01_00234802 predicted 740
8 SASI_Hs01_00234803 predicted 421
9 SASI_Hs01_00234804 predicted 453
10 SASI_Hs02_00371181 predicted 295
11 SASI_Hs01_00234805 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081799 predicted 1586
2 SASI_Hs01_00081800 predicted 1588
3 SASI_Hs01_00081801 predicted 943
4 SASI_Hs01_00081802 predicted 1114
5 SASI_Hs01_00081803 predicted 452
6 SASI_Hs01_00081804 predicted 707
7 SASI_Hs01_00081805 predicted 1098
8 SASI_Hs01_00081806 predicted 742
9 SASI_Hs02_00371182 predicted 618
10 SASI_Hs01_00081808 predicted 722
11 SASI_Hs01_00081807 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127656 predicted 925
2 SASI_Hs01_00127648 predicted 1037
3 SASI_Hs01_00127649 predicted 836
4 SASI_Hs01_00127650 predicted 837
5 SASI_Hs01_00127651 predicted 1024
6 SASI_Hs01_00127652 predicted 916
7 SASI_Hs01_00127653 predicted 1038
8 SASI_Hs01_00127654 predicted 882
9 SASI_Hs01_00127655 predicted 872
10 SASI_Hs01_00127657 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251422 predicted 487
2 SASI_Rn02_00251423 predicted 794
3 SASI_Rn02_00251424 predicted 859
4 SASI_Rn02_00251425 predicted 406
5 SASI_Rn02_00251426 predicted 899
6 SASI_Rn02_00251427 predicted 1518
7 SASI_Rn02_00251428 predicted 474
8 SASI_Rn02_00251429 predicted 431
9 SASI_Rn02_00251430 predicted 462
10 SASI_Rn02_00251431 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117375 predicted 262
2 SASI_Rn01_00117376 predicted 335
3 SASI_Rn01_00117377 predicted 331
4 SASI_Rn01_00117378 predicted 353
5 SASI_Rn01_00117379 predicted 292
6 SASI_Rn01_00117380 predicted 272
7 SASI_Rn01_00117381 predicted 327
8 SASI_Rn01_00117382 predicted 207
9 SASI_Rn01_00117383 predicted 241
10 SASI_Rn01_00117384 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118187 predicted 137
2 SASI_Rn01_00118188 predicted 123
3 SASI_Rn01_00118189 predicted 360
4 SASI_Rn01_00118190 predicted 282
5 SASI_Rn02_00261789 predicted 141
6 SASI_Rn01_00118193 predicted 153
7 SASI_Rn01_00118194 predicted 338
8 SASI_Rn01_00118195 predicted 307
9 SASI_Rn02_00261790 predicted 155
10 SASI_Rn02_00261791 predicted 166
11 SASI_Rn01_00118186 predicted 380
12 SASI_Rn01_00118191 predicted 76
13 SASI_Rn01_00118192 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305938 predicted 460
2 SASI_Mm02_00305939 predicted 550
3 SASI_Mm02_00305940 predicted 382
4 SASI_Mm02_00305941 predicted 620
5 SASI_Mm02_00305942 predicted 1057
6 SASI_Mm02_00305943 predicted 651
7 SASI_Mm02_00305944 predicted 360
8 SASI_Mm02_00305945 predicted 601
9 SASI_Mm02_00305946 predicted 431
10 SASI_Mm02_00305947 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305948 predicted 702
2 SASI_Mm02_00305949 predicted 1055
3 SASI_Mm02_00305950 predicted 833
4 SASI_Mm02_00305951 predicted 742
5 SASI_Mm02_00305952 predicted 855
6 SASI_Mm02_00305953 predicted 1019
7 SASI_Mm02_00305954 predicted 839
8 SASI_Mm02_00305955 predicted 877
9 SASI_Mm02_00305956 predicted 806
10 SASI_Mm02_00305957 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305958 predicted 556
2 SASI_Mm02_00305959 predicted 914
3 SASI_Mm02_00305960 predicted 690
4 SASI_Mm02_00305961 predicted 601
5 SASI_Mm02_00305962 predicted 706
6 SASI_Mm02_00305963 predicted 876
7 SASI_Mm02_00305964 predicted 694
8 SASI_Mm02_00305965 predicted 734
9 SASI_Mm02_00305966 predicted 659
10 SASI_Mm02_00305967 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305968 predicted 1090
2 SASI_Mm02_00305969 predicted 1137
3 SASI_Mm02_00305970 predicted 1296
4 SASI_Mm02_00305971 predicted 1174
5 SASI_Mm02_00305972 predicted 1091
6 SASI_Mm02_00305973 predicted 1071
7 SASI_Mm02_00305974 predicted 1179
8 SASI_Mm02_00305975 predicted 1089
9 SASI_Mm02_00305976 predicted 1199
10 SASI_Mm02_00305977 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305978 predicted 578
2 SASI_Mm02_00305979 predicted 736
3 SASI_Mm02_00305980 predicted 470
4 SASI_Mm02_00305981 predicted 673
5 SASI_Mm02_00305982 predicted 592
6 SASI_Mm02_00305983 predicted 485
7 SASI_Mm02_00305984 predicted 661
8 SASI_Mm02_00305985 predicted 585
9 SASI_Mm02_00305986 predicted 132
10 SASI_Mm02_00305987 predicted 102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305988 predicted 543
2 SASI_Mm02_00305989 predicted 697
3 SASI_Mm02_00305990 predicted 439
4 SASI_Mm02_00305991 predicted 641
5 SASI_Mm02_00305992 predicted 555
6 SASI_Mm02_00305993 predicted 447
7 SASI_Mm02_00305994 predicted 624
8 SASI_Mm02_00305995 predicted 544
9 SASI_Mm02_00305996 predicted 91
10 SASI_Mm02_00305997 predicted 67
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305998 predicted 1223
2 SASI_Mm02_00305999 predicted 526
3 SASI_Mm02_00306000 predicted 698
4 SASI_Mm02_00306001 predicted 560
5 SASI_Mm02_00306002 predicted 375
6 SASI_Mm02_00306003 predicted 768
7 SASI_Mm02_00306004 predicted 1238
8 SASI_Mm02_00306005 predicted 539
9 SASI_Mm02_00306006 predicted 369
10 SASI_Mm02_00306007 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306008 predicted 1156
2 SASI_Mm02_00306009 predicted 1205
3 SASI_Mm02_00306010 predicted 1354
4 SASI_Mm02_00306011 predicted 1238
5 SASI_Mm02_00306012 predicted 1152
6 SASI_Mm02_00306013 predicted 1127
7 SASI_Mm02_00306014 predicted 1242
8 SASI_Mm02_00306015 predicted 1151
9 SASI_Mm02_00306016 predicted 1261
10 SASI_Mm02_00306017 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306018 predicted 1111
2 SASI_Mm02_00306019 predicted 1163
3 SASI_Mm02_00306020 predicted 1322
4 SASI_Mm02_00306021 predicted 1199
5 SASI_Mm02_00306022 predicted 1119
6 SASI_Mm02_00306023 predicted 1092
7 SASI_Mm02_00306024 predicted 1203
8 SASI_Mm02_00306025 predicted 1117
9 SASI_Mm02_00306026 predicted 1223
10 SASI_Mm02_00306027 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306028 predicted 1280
2 SASI_Mm02_00306029 predicted 1221
3 SASI_Mm02_00306030 predicted 694
4 SASI_Mm02_00306031 predicted 377
5 SASI_Mm02_00306032 predicted 1292
6 SASI_Mm02_00306033 predicted 767
7 SASI_Mm02_00306034 predicted 935
8 SASI_Mm02_00306035 predicted 541
9 SASI_Mm02_00306036 predicted 1206
10 SASI_Mm02_00306037 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322144 predicted 465
2 SASI_Mm01_00084177 predicted 548
3 SASI_Mm02_00322145 predicted 373
4 SASI_Mm01_00084179 predicted 625
5 SASI_Mm01_00084180 predicted 1091
6 SASI_Mm02_00322146 predicted 368
7 SASI_Mm01_00084182 predicted 595
8 SASI_Mm02_00322147 predicted 431
9 SASI_Mm02_00322148 predicted 334
10 SASI_Mm01_00084184 predicted 738
11 SASI_Mm01_00084175 predicted 909
12 SASI_Mm01_00084176 predicted 998
13 SASI_Mm01_00084178 predicted 918
14 SASI_Mm01_00084181 predicted 983
15 SASI_Mm01_00084183 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001881
VALIDATED
CREM MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element modulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-1001s1c1
Sequence:CCGGGCGAACATAAATGTCTGTATTCTCGAGAATACAGACATTTATGTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-476s1c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-718s1c1
Sequence:CCGGGCTAGCTTTAAGTCTTCTCTACTCGAGTAGAGAAGACTTAAAGCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-585s1c1
Sequence:CCGGCCAAGATTGAAGAAGAGAGATCTCGAGATCTCTCTTCTTCAATCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-520s1c1
Sequence:CCGGCCTTTCACGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCGTGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-614s21c1
Sequence:CCGGGAAGGAACACCACCTAGTATTCTCGAGAATACTAGGTGGTGTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001881.2-851s21c1
Sequence:CCGGGTATTGACAGCTGTCATATAACTCGAGTTATATGACAGCTGTCAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-476s21c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-644s21c1
Sequence:CCGGGCAGTACCAACTAGCATATATCTCGAGATATATGCTAGTTGGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-694s21c1
Sequence:CCGGTGCTGCAATTCGATATGATACCTCGAGGTATCATATCGAATTGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001881
VALIDATED
CREM MISSION shRNA shRNA Plasmid DNA
cAMP responsive element modulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-1001s1c1
Sequence:CCGGGCGAACATAAATGTCTGTATTCTCGAGAATACAGACATTTATGTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-476s1c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-718s1c1
Sequence:CCGGGCTAGCTTTAAGTCTTCTCTACTCGAGTAGAGAAGACTTAAAGCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-585s1c1
Sequence:CCGGCCAAGATTGAAGAAGAGAGATCTCGAGATCTCTCTTCTTCAATCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-520s1c1
Sequence:CCGGCCTTTCACGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCGTGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-614s21c1
Sequence:CCGGGAAGGAACACCACCTAGTATTCTCGAGAATACTAGGTGGTGTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001881.2-851s21c1
Sequence:CCGGGTATTGACAGCTGTCATATAACTCGAGTTATATGACAGCTGTCAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-476s21c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-644s21c1
Sequence:CCGGGCAGTACCAACTAGCATATATCTCGAGATATATGCTAGTTGGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-694s21c1
Sequence:CCGGTGCTGCAATTCGATATGATACCTCGAGGTATCATATCGAATTGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001881
VALIDATED
CREM MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element modulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-1001s1c1
Sequence:CCGGGCGAACATAAATGTCTGTATTCTCGAGAATACAGACATTTATGTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-476s1c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-718s1c1
Sequence:CCGGGCTAGCTTTAAGTCTTCTCTACTCGAGTAGAGAAGACTTAAAGCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001881.2-585s1c1
Sequence:CCGGCCAAGATTGAAGAAGAGAGATCTCGAGATCTCTCTTCTTCAATCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001881.2-520s1c1
Sequence:CCGGCCTTTCACGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCGTGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-614s21c1
Sequence:CCGGGAAGGAACACCACCTAGTATTCTCGAGAATACTAGGTGGTGTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001881.2-851s21c1
Sequence:CCGGGTATTGACAGCTGTCATATAACTCGAGTTATATGACAGCTGTCAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-476s21c1
Sequence:CCGGGCAGAATCAGAAGGTGTAATTCTCGAGAATTACACCTTCTGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-644s21c1
Sequence:CCGGGCAGTACCAACTAGCATATATCTCGAGATATATGCTAGTTGGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001881.2-694s21c1
Sequence:CCGGTGCTGCAATTCGATATGATACCTCGAGGTATCATATCGAATTGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013498
CREM MISSION shRNA Bacterial Glycerol Stock
cAMP responsive element modulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013498.1-1505s1c1
Sequence:CCGGCCATAGAGATACCTCAGGAAACTCGAGTTTCCTGAGGTATCTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-270s1c1
Sequence:CCGGGCCTGGTATTCCCAAGATTGACTCGAGTCAATCTTGGGAATACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-683s1c1
Sequence:CCGGAGGCCCTCAAAGACCTTTATTCTCGAGAATAAAGGTCTTTGAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-271s1c1
Sequence:CCGGCCTGGTATTCCCAAGATTGAACTCGAGTTCAATCTTGGGAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-182s1c1
Sequence:CCGGCAGAAGTAATTGATTCGCATACTCGAGTATGCGAATCAATTACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013498
CREM MISSION shRNA shRNA Plasmid DNA
cAMP responsive element modulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013498.1-1505s1c1
Sequence:CCGGCCATAGAGATACCTCAGGAAACTCGAGTTTCCTGAGGTATCTCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-270s1c1
Sequence:CCGGGCCTGGTATTCCCAAGATTGACTCGAGTCAATCTTGGGAATACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-683s1c1
Sequence:CCGGAGGCCCTCAAAGACCTTTATTCTCGAGAATAAAGGTCTTTGAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-271s1c1
Sequence:CCGGCCTGGTATTCCCAAGATTGAACTCGAGTTCAATCTTGGGAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-182s1c1
Sequence:CCGGCAGAAGTAATTGATTCGCATACTCGAGTATGCGAATCAATTACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013498
CREM MISSION shRNA Lentiviral Transduction Particles
cAMP responsive element modulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013498.1-1505s1c1
Sequence:CCGGCCATAGAGATACCTCAGGAAACTCGAGTTTCCTGAGGTATCTCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-270s1c1
Sequence:CCGGGCCTGGTATTCCCAAGATTGACTCGAGTCAATCTTGGGAATACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-683s1c1
Sequence:CCGGAGGCCCTCAAAGACCTTTATTCTCGAGAATAAAGGTCTTTGAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-271s1c1
Sequence:CCGGCCTGGTATTCCCAAGATTGAACTCGAGTTCAATCTTGGGAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013498.1-182s1c1
Sequence:CCGGCAGAAGTAATTGATTCGCATACTCGAGTATGCGAATCAATTACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)