EMAIL THIS PAGE TO A FRIEND

CRH

corticotropin releasing hormone

95 Gene Product Result for
Synonyms: CRF
UniProtKB ID: P06850, B3KQS4
Gene ID:
Human(1392) Summary: Corticotropin-releasing hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus in response to stress. Marked reduction in this protein has been observed in association with Alzheimer disease and autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Apr 2010]
Mouse(12918) corticotropin releasing hormone
Rat(81648) corticotropin releasing hormone
chicken(404297) corticotropin releasing hormone
dog(486977) corticotropin releasing hormone
domestic cat(692345) corticotropin releasing hormone
cow(280755) corticotropin releasing hormone
sheep(101121525) corticotropin releasing hormone
Domestic Rabbit(100301553) corticotropin releasing hormone
domestic guinea pig(100719294) corticotropin releasing hormone
naked mole-rat(101717831) corticotropin releasing hormone
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
A4933 Astressin ≥90% (HPLC) human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C2917 Corticotropin Releasing Factor Antagonist ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_205769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_205769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000756 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000756 Rosetta Predictions human pricing
NM_031019 Rosetta Predictions rat pricing
NM_205769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169843 predicted 486
2 SASI_Hs01_00169845 predicted 477
3 SASI_Hs01_00169848 predicted 303
4 SASI_Hs01_00169849 predicted 371
5 SASI_Hs01_00169850 predicted 494
6 SASI_Hs01_00169851 predicted 372
7 SASI_Hs02_00303189 predicted 360
8 SASI_Hs02_00303190 predicted 368
9 SASI_Hs01_00169844 predicted 293
10 SASI_Hs02_00303191 predicted 1027
11 SASI_Hs01_00169846 predicted 585
12 SASI_Hs01_00169847 predicted 585
13 SASI_Hs01_00169852 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030318 predicted 341
2 SASI_Rn02_00264213 predicted 460
3 SASI_Rn01_00030319 predicted 285
4 SASI_Rn01_00030320 predicted 452
5 SASI_Rn01_00030321 predicted 324
6 SASI_Rn01_00030323 predicted 342
7 SASI_Rn01_00030324 predicted 286
8 SASI_Rn01_00030325 predicted 455
9 SASI_Rn01_00030326 predicted 331
10 SASI_Rn01_00030327 predicted 514
11 SASI_Rn01_00030322 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105652 predicted 613
2 SASI_Mm01_00105653 predicted 984
3 SASI_Mm02_00351772 predicted 714
4 SASI_Mm01_00105654 predicted 733
5 SASI_Mm01_00105655 predicted 688
6 SASI_Mm01_00105656 predicted 960
7 SASI_Mm01_00105657 predicted 826
8 SASI_Mm01_00105658 predicted 972
9 SASI_Mm01_00105659 predicted 964
10 SASI_Mm01_00105660 predicted 817
11 SASI_Mm01_00105661 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205769
CRH MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-740s21c1
Sequence:CCGGGAAATGTTGCGCTTGGCCAAACTCGAGTTTGGCCAAGCGCAACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-625s21c1
Sequence:CCGGATCTCTCTGGATCTCACCTTCCTCGAGGAAGGTGAGATCCAGAGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-463s21c1
Sequence:CCGGGACCAGGCTGCGGCTAACTTTCTCGAGAAAGTTAGCCGCAGCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-379s21c1
Sequence:CCGGGGGAATCTCAACAGAAGTCCCCTCGAGGGGACTTCTGTTGAGATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-687s21c1
Sequence:CCGGGTTAGCTCAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGAGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205769.1-977s21c1
Sequence:CCGGATGTGCAAATAAGCGTCTTTACTCGAGTAAAGACGCTTATTTGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-718s1c1
Sequence:CCGGCTGATGGAGATTATCGGGAAACTCGAGTTTCCCGATAATCTCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-345s1c1
Sequence:CCGGGATCCGCATGGGTGAAGAATACTCGAGTATTCTTCACCCATGCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-297s1c1
Sequence:CCGGCTTGAATTTCTTGCAGCCGGACTCGAGTCCGGCTGCAAGAAATTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205769
CRH MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-740s21c1
Sequence:CCGGGAAATGTTGCGCTTGGCCAAACTCGAGTTTGGCCAAGCGCAACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-625s21c1
Sequence:CCGGATCTCTCTGGATCTCACCTTCCTCGAGGAAGGTGAGATCCAGAGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-463s21c1
Sequence:CCGGGACCAGGCTGCGGCTAACTTTCTCGAGAAAGTTAGCCGCAGCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-379s21c1
Sequence:CCGGGGGAATCTCAACAGAAGTCCCCTCGAGGGGACTTCTGTTGAGATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-687s21c1
Sequence:CCGGGTTAGCTCAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGAGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205769.1-977s21c1
Sequence:CCGGATGTGCAAATAAGCGTCTTTACTCGAGTAAAGACGCTTATTTGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-718s1c1
Sequence:CCGGCTGATGGAGATTATCGGGAAACTCGAGTTTCCCGATAATCTCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-345s1c1
Sequence:CCGGGATCCGCATGGGTGAAGAATACTCGAGTATTCTTCACCCATGCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-297s1c1
Sequence:CCGGCTTGAATTTCTTGCAGCCGGACTCGAGTCCGGCTGCAAGAAATTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205769
CRH MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-740s21c1
Sequence:CCGGGAAATGTTGCGCTTGGCCAAACTCGAGTTTGGCCAAGCGCAACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-625s21c1
Sequence:CCGGATCTCTCTGGATCTCACCTTCCTCGAGGAAGGTGAGATCCAGAGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-463s21c1
Sequence:CCGGGACCAGGCTGCGGCTAACTTTCTCGAGAAAGTTAGCCGCAGCCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-379s21c1
Sequence:CCGGGGGAATCTCAACAGAAGTCCCCTCGAGGGGACTTCTGTTGAGATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205769.1-687s21c1
Sequence:CCGGGTTAGCTCAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGAGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205769.1-977s21c1
Sequence:CCGGATGTGCAAATAAGCGTCTTTACTCGAGTAAAGACGCTTATTTGCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-718s1c1
Sequence:CCGGCTGATGGAGATTATCGGGAAACTCGAGTTTCCCGATAATCTCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-345s1c1
Sequence:CCGGGATCCGCATGGGTGAAGAATACTCGAGTATTCTTCACCCATGCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205769.1-297s1c1
Sequence:CCGGCTTGAATTTCTTGCAGCCGGACTCGAGTCCGGCTGCAAGAAATTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000756
CRH MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-998s21c1
Sequence:CCGGTTTCCGTTTCCAGGTGTTTATCTCGAGATAAACACCTGGAAACGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-722s21c1
Sequence:CCGGGTTAGCACAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGTGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-686s21c1
Sequence:CCGGCCTCCGGGAAGTCTTGGAAATCTCGAGATTTCCAAGACTTCCCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-304s21c1
Sequence:CCGGACCCTCAGCCCTTGGATTTCTCTCGAGAGAAATCCAAGGGCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-851s21c1
Sequence:CCGGAGCGCTGCTCTTATGCCATTTCTCGAGAAATGGCATAAGAGCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000756.1-964s1c1
Sequence:CCGGGCAACACAATGTTATTCGTTTCTCGAGAAACGAATAACATTGTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-746s1c1
Sequence:CCGGCAGGAAACTCATGGAGATTATCTCGAGATAATCTCCATGAGTTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-753s1c1
Sequence:CCGGCTCATGGAGATTATTGGGAAACTCGAGTTTCCCAATAATCTCCATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000756
CRH MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-998s21c1
Sequence:CCGGTTTCCGTTTCCAGGTGTTTATCTCGAGATAAACACCTGGAAACGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-722s21c1
Sequence:CCGGGTTAGCACAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGTGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-686s21c1
Sequence:CCGGCCTCCGGGAAGTCTTGGAAATCTCGAGATTTCCAAGACTTCCCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-304s21c1
Sequence:CCGGACCCTCAGCCCTTGGATTTCTCTCGAGAGAAATCCAAGGGCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-851s21c1
Sequence:CCGGAGCGCTGCTCTTATGCCATTTCTCGAGAAATGGCATAAGAGCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000756.1-964s1c1
Sequence:CCGGGCAACACAATGTTATTCGTTTCTCGAGAAACGAATAACATTGTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-746s1c1
Sequence:CCGGCAGGAAACTCATGGAGATTATCTCGAGATAATCTCCATGAGTTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-753s1c1
Sequence:CCGGCTCATGGAGATTATTGGGAAACTCGAGTTTCCCAATAATCTCCATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000756
CRH MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-998s21c1
Sequence:CCGGTTTCCGTTTCCAGGTGTTTATCTCGAGATAAACACCTGGAAACGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-722s21c1
Sequence:CCGGGTTAGCACAGCAAGCTCACAGCTCGAGCTGTGAGCTTGCTGTGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-686s21c1
Sequence:CCGGCCTCCGGGAAGTCTTGGAAATCTCGAGATTTCCAAGACTTCCCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000756.1-304s21c1
Sequence:CCGGACCCTCAGCCCTTGGATTTCTCTCGAGAGAAATCCAAGGGCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000756.1-851s21c1
Sequence:CCGGAGCGCTGCTCTTATGCCATTTCTCGAGAAATGGCATAAGAGCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000756.1-964s1c1
Sequence:CCGGGCAACACAATGTTATTCGTTTCTCGAGAAACGAATAACATTGTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-746s1c1
Sequence:CCGGCAGGAAACTCATGGAGATTATCTCGAGATAATCTCCATGAGTTTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000756.1-753s1c1
Sequence:CCGGCTCATGGAGATTATTGGGAAACTCGAGTTTCCCAATAATCTCCATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)