EMAIL THIS PAGE TO A FRIEND

CRHBP

corticotropin releasing hormone binding protein

55 Gene Product Result for
Synonyms: CRF-BP CRFBP
UniProtKB ID: P24387, Q53F32, Q6FHT5
Gene ID:
Human(1393) Summary: Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. [provided by RefSeq, Jul 2008]
Mouse(12919) corticotropin releasing hormone binding protein
Rat(29625) corticotropin releasing hormone binding protein
Zebrafish(445065) corticotropin releasing hormone binding protein
chicken(427214) corticotropin releasing hormone binding protein
cow(540087) corticotropin releasing hormone binding protein
dog(610584) corticotropin releasing hormone binding protein
domestic cat(101083142) corticotropin releasing hormone binding protein
naked mole-rat(101709963) corticotropin releasing hormone binding protein
domestic guinea pig(100725389) corticotropin releasing hormone binding protein
sheep(101111457) corticotropin releasing hormone binding protein
sheep(443354) corticotropin releasing hormone binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1392 Human CRHBP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001882 Rosetta Predictions human pricing
NM_139183 Rosetta Predictions rat pricing
NM_198408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081057 predicted 548
2 SASI_Hs01_00081058 predicted 788
3 SASI_Hs01_00081059 predicted 769
4 SASI_Hs01_00081060 predicted 681
5 SASI_Hs01_00081062 predicted 1142
6 SASI_Hs01_00081063 predicted 944
7 SASI_Hs01_00081064 predicted 775
8 SASI_Hs01_00081065 predicted 604
9 SASI_Hs01_00081066 predicted 884
10 SASI_Hs02_00332734 predicted 929
11 SASI_Hs01_00081061 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049114 predicted 572
2 SASI_Rn01_00049116 predicted 609
3 SASI_Rn01_00049117 predicted 550
4 SASI_Rn01_00049118 predicted 622
5 SASI_Rn02_00268508 predicted 521
6 SASI_Rn01_00049120 predicted 1117
7 SASI_Rn01_00049121 predicted 1024
8 SASI_Rn01_00049122 predicted 977
9 SASI_Rn01_00049123 predicted 1162
10 SASI_Rn02_00268509 predicted 1077
11 SASI_Rn01_00049115 predicted 1032
12 SASI_Rn01_00049119 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036490 predicted 642
2 SASI_Mm01_00036491 predicted 1144
3 SASI_Mm01_00036492 predicted 649
4 SASI_Mm01_00036493 predicted 647
5 SASI_Mm01_00036494 predicted 803
6 SASI_Mm01_00036496 predicted 1011
7 SASI_Mm01_00036497 predicted 258
8 SASI_Mm01_00036495 predicted 1059
9 SASI_Mm01_00036498 predicted 650
10 SASI_Mm02_00350946 predicted 539
11 SASI_Mm01_00036499 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001882
CRHBP MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-757s1c1
Sequence:CCGGCTGGGACACGTAAATGGTCTTCTCGAGAAGACCATTTACGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-577s1c1
Sequence:CCGGCGAGTCCATGAACCAGGAAATCTCGAGATTTCCTGGTTCATGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-625s1c1
Sequence:CCGGCCCAACCTCTTTCCTTGCAATCTCGAGATTGCAAGGAAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-508s1c1
Sequence:CCGGGATTTCTGTGAGAGTGGTCTTCTCGAGAAGACCACTCTCACAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001882.2-366s1c1
Sequence:CCGGGTTCATTACCATCCACTACGACTCGAGTCGTAGTGGATGGTAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-909s1c1
Sequence:CCGGGATGAAAGTTGGCTGTGACAACTCGAGTTGTCACAGCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1515s21c1
Sequence:CCGGATTCTTTGATGTGCTACAAACCTCGAGGTTTGTAGCACATCAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1250s21c1
Sequence:CCGGATAACCAACCCAGTGATTTACCTCGAGGTAAATCACTGGGTTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-600s21c1
Sequence:CCGGGCGACTTCCTGAAGGTATTTGCTCGAGCAAATACCTTCAGGAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-844s21c1
Sequence:CCGGGACTCCAAATGGAAAGTTTACCTCGAGGTAAACTTTCCATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001882
CRHBP MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-757s1c1
Sequence:CCGGCTGGGACACGTAAATGGTCTTCTCGAGAAGACCATTTACGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-577s1c1
Sequence:CCGGCGAGTCCATGAACCAGGAAATCTCGAGATTTCCTGGTTCATGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-625s1c1
Sequence:CCGGCCCAACCTCTTTCCTTGCAATCTCGAGATTGCAAGGAAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-508s1c1
Sequence:CCGGGATTTCTGTGAGAGTGGTCTTCTCGAGAAGACCACTCTCACAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001882.2-366s1c1
Sequence:CCGGGTTCATTACCATCCACTACGACTCGAGTCGTAGTGGATGGTAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-909s1c1
Sequence:CCGGGATGAAAGTTGGCTGTGACAACTCGAGTTGTCACAGCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1515s21c1
Sequence:CCGGATTCTTTGATGTGCTACAAACCTCGAGGTTTGTAGCACATCAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1250s21c1
Sequence:CCGGATAACCAACCCAGTGATTTACCTCGAGGTAAATCACTGGGTTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-600s21c1
Sequence:CCGGGCGACTTCCTGAAGGTATTTGCTCGAGCAAATACCTTCAGGAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-844s21c1
Sequence:CCGGGACTCCAAATGGAAAGTTTACCTCGAGGTAAACTTTCCATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001882
CRHBP MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-757s1c1
Sequence:CCGGCTGGGACACGTAAATGGTCTTCTCGAGAAGACCATTTACGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-577s1c1
Sequence:CCGGCGAGTCCATGAACCAGGAAATCTCGAGATTTCCTGGTTCATGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-625s1c1
Sequence:CCGGCCCAACCTCTTTCCTTGCAATCTCGAGATTGCAAGGAAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-508s1c1
Sequence:CCGGGATTTCTGTGAGAGTGGTCTTCTCGAGAAGACCACTCTCACAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001882.2-366s1c1
Sequence:CCGGGTTCATTACCATCCACTACGACTCGAGTCGTAGTGGATGGTAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001882.2-909s1c1
Sequence:CCGGGATGAAAGTTGGCTGTGACAACTCGAGTTGTCACAGCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1515s21c1
Sequence:CCGGATTCTTTGATGTGCTACAAACCTCGAGGTTTGTAGCACATCAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001882.3-1250s21c1
Sequence:CCGGATAACCAACCCAGTGATTTACCTCGAGGTAAATCACTGGGTTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-600s21c1
Sequence:CCGGGCGACTTCCTGAAGGTATTTGCTCGAGCAAATACCTTCAGGAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001882.3-844s21c1
Sequence:CCGGGACTCCAAATGGAAAGTTTACCTCGAGGTAAACTTTCCATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198408
CRHBP MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-588s1c1
Sequence:CCGGCCAGGAAATGGATTCACGATACTCGAGTATCGTGAATCCATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198408.1-1453s1c1
Sequence:CCGGCCAAAGGAATTGCATCTGTTACTCGAGTAACAGATGCAATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-521s1c1
Sequence:CCGGTGGTCTTACCAGAAGGAGCATCTCGAGATGCTCCTTCTGGTAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-206s1c1
Sequence:CCGGGCTCTTCAGTGCCAATCTGAACTCGAGTTCAGATTGGCACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-660s1c1
Sequence:CCGGCCGAGTGGAAGGTTTACTTTACTCGAGTAAAGTAAACCTTCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-487s21c1
Sequence:CCGGATTTGATGGTTGGATCCTAAACTCGAGTTTAGGATCCAACCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-190s21c1
Sequence:CCGGGATCCTCCTGACAGCTCTAAGCTCGAGCTTAGAGCTGTCAGGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-823s21c1
Sequence:CCGGCTTGCATGGCCTTCAGTTAAACTCGAGTTTAACTGAAGGCCATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-655s21c1
Sequence:CCGGTGGATTCACGATAACCATAAACTCGAGTTTATGGTTATCGTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198408
CRHBP MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-588s1c1
Sequence:CCGGCCAGGAAATGGATTCACGATACTCGAGTATCGTGAATCCATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198408.1-1453s1c1
Sequence:CCGGCCAAAGGAATTGCATCTGTTACTCGAGTAACAGATGCAATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-521s1c1
Sequence:CCGGTGGTCTTACCAGAAGGAGCATCTCGAGATGCTCCTTCTGGTAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-206s1c1
Sequence:CCGGGCTCTTCAGTGCCAATCTGAACTCGAGTTCAGATTGGCACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-660s1c1
Sequence:CCGGCCGAGTGGAAGGTTTACTTTACTCGAGTAAAGTAAACCTTCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-487s21c1
Sequence:CCGGATTTGATGGTTGGATCCTAAACTCGAGTTTAGGATCCAACCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-190s21c1
Sequence:CCGGGATCCTCCTGACAGCTCTAAGCTCGAGCTTAGAGCTGTCAGGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-823s21c1
Sequence:CCGGCTTGCATGGCCTTCAGTTAAACTCGAGTTTAACTGAAGGCCATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-655s21c1
Sequence:CCGGTGGATTCACGATAACCATAAACTCGAGTTTATGGTTATCGTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198408
CRHBP MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-588s1c1
Sequence:CCGGCCAGGAAATGGATTCACGATACTCGAGTATCGTGAATCCATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198408.1-1453s1c1
Sequence:CCGGCCAAAGGAATTGCATCTGTTACTCGAGTAACAGATGCAATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-521s1c1
Sequence:CCGGTGGTCTTACCAGAAGGAGCATCTCGAGATGCTCCTTCTGGTAAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-206s1c1
Sequence:CCGGGCTCTTCAGTGCCAATCTGAACTCGAGTTCAGATTGGCACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198408.1-660s1c1
Sequence:CCGGCCGAGTGGAAGGTTTACTTTACTCGAGTAAAGTAAACCTTCCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-487s21c1
Sequence:CCGGATTTGATGGTTGGATCCTAAACTCGAGTTTAGGATCCAACCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-190s21c1
Sequence:CCGGGATCCTCCTGACAGCTCTAAGCTCGAGCTTAGAGCTGTCAGGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-823s21c1
Sequence:CCGGCTTGCATGGCCTTCAGTTAAACTCGAGTTTAACTGAAGGCCATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198408.3-655s21c1
Sequence:CCGGTGGATTCACGATAACCATAAACTCGAGTTTATGGTTATCGTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks