EMAIL THIS PAGE TO A FRIEND

CRHR1-IT1

CRHR1 intronic transcript 1 (non-protein coding)

124 Gene Product Result for
Synonyms: C17orf69
Species: Human CRHR1-IT1(147081)
UniProtKB ID: Q96LR1, C9JG53
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152466 Rosetta Predictions human pricing
XR_040436 Rosetta Predictions human pricing
XR_040437 Rosetta Predictions human pricing
XR_040438 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021460 predicted 476
2 SASI_Hs01_00021461 predicted 480
3 SASI_Hs01_00021462 predicted 511
4 SASI_Hs01_00021463 predicted 505
5 SASI_Hs01_00021464 predicted 521
6 SASI_Hs01_00021465 predicted 511
7 SASI_Hs01_00021466 predicted 328
8 SASI_Hs01_00021467 predicted 490
9 SASI_Hs01_00021468 predicted 351
10 SASI_Hs01_00021469 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518861 predicted 212
2 SASI_Hs02_00518862 predicted 197
3 SASI_Hs02_00518863 predicted 215
4 SASI_Hs02_00518864 predicted 205
5 SASI_Hs02_00518865 predicted 200
6 SASI_Hs02_00518866 predicted 251
7 SASI_Hs02_00518867 predicted 170
8 SASI_Hs02_00518868 predicted 930
9 SASI_Hs02_00518869 predicted 137
10 SASI_Hs02_00518870 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518871 predicted 207
2 SASI_Hs02_00518872 predicted 196
3 SASI_Hs02_00518873 predicted 209
4 SASI_Hs02_00518874 predicted 197
5 SASI_Hs02_00518875 predicted 199
6 SASI_Hs02_00518876 predicted 248
7 SASI_Hs02_00518877 predicted 170
8 SASI_Hs02_00518878 predicted 927
9 SASI_Hs02_00518879 predicted 140
10 SASI_Hs02_00518880 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518881 predicted 207
2 SASI_Hs02_00518882 predicted 194
3 SASI_Hs02_00518883 predicted 208
4 SASI_Hs02_00518884 predicted 197
5 SASI_Hs02_00518885 predicted 203
6 SASI_Hs02_00518886 predicted 256
7 SASI_Hs02_00518887 predicted 173
8 SASI_Hs02_00518888 predicted 928
9 SASI_Hs02_00518889 predicted 139
10 SASI_Hs02_00518890 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152466
CRHR1-IT1 MISSION shRNA Bacterial Glycerol Stock
CRHR1 intronic transcript 1 (non-protein coding)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152466.1-490s1c1
Sequence:CCGGCATACTTCTAAGTACACCCTACTCGAGTAGGGTGTACTTAGAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-881s1c1
Sequence:CCGGGTTCACTTACAATGGGTAAATCTCGAGATTTACCCATTGTAAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-1066s1c1
Sequence:CCGGCGTCCAGCTTCTGCTTGAATACTCGAGTATTCAAGCAGAAGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152466
CRHR1-IT1 MISSION shRNA shRNA Plasmid DNA
CRHR1 intronic transcript 1 (non-protein coding)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152466.1-490s1c1
Sequence:CCGGCATACTTCTAAGTACACCCTACTCGAGTAGGGTGTACTTAGAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-881s1c1
Sequence:CCGGGTTCACTTACAATGGGTAAATCTCGAGATTTACCCATTGTAAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-1066s1c1
Sequence:CCGGCGTCCAGCTTCTGCTTGAATACTCGAGTATTCAAGCAGAAGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152466
CRHR1-IT1 MISSION shRNA Lentiviral Transduction Particles
CRHR1 intronic transcript 1 (non-protein coding)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152466.1-490s1c1
Sequence:CCGGCATACTTCTAAGTACACCCTACTCGAGTAGGGTGTACTTAGAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-881s1c1
Sequence:CCGGGTTCACTTACAATGGGTAAATCTCGAGATTTACCCATTGTAAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152466.1-1066s1c1
Sequence:CCGGCGTCCAGCTTCTGCTTGAATACTCGAGTATTCAAGCAGAAGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks