EMAIL THIS PAGE TO A FRIEND

CRHR1

corticotropin releasing hormone receptor 1

68 Gene Product Result for
Synonyms: CRF-R CRF-R-1 CRF-R1 CRF1 CRFR-1 CRFR1 CRH-R-1 CRH-R1 CRH-R1h CRHR CRHR1L CRHR1f
UniProtKB ID: P34998, B4DIE9, Q13008, Q4QRJ1, Q9UK64
Gene ID:
Human(1394) Summary: This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants, one of which represents a read-through transcript with the neighboring gene MGC57346. [provided by RefSeq, Jan 2012]
Mouse(12921) corticotropin releasing hormone receptor 1
Rat(58959) corticotropin releasing hormone receptor 1
sheep(443025) corticotropin releasing hormone receptor 1
Domestic Rabbit(100302436) corticotropin releasing hormone receptor 1
domestic guinea pig(100729987) corticotropin releasing hormone receptor 1
naked mole-rat(101721828) corticotropin releasing hormone receptor 1
Zebrafish(567940) corticotropin releasing hormone receptor 1
cow(281716) corticotropin releasing hormone receptor 1
Horse(100065598) corticotropin releasing hormone receptor 1
chicken(374218) corticotropin releasing hormone receptor 1
dog(610380) corticotropin releasing hormone receptor 1
domestic cat(723971) corticotropin releasing hormone receptor 1
domestic cat(101089308) corticotropin releasing hormone receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N3911 NBI 27914 ≥98% (HPLC) human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004382 Rosetta Predictions human pricing
NM_030999 Rosetta Predictions rat pricing
NM_007762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337473 predicted 448
2 SASI_Hs01_00161096 predicted 719
3 SASI_Hs02_00337474 predicted 1545
4 SASI_Hs01_00161099 predicted 1428
5 SASI_Hs01_00161101 predicted 1934
6 SASI_Hs02_00337475 predicted 1330
7 SASI_Hs02_00337476 predicted 688
8 SASI_Hs02_00337477 predicted 331
9 SASI_Hs02_00337478 predicted 1771
10 SASI_Hs02_00337479 predicted 1901
11 SASI_Hs01_00161095 predicted 457
12 SASI_Hs01_00161097 predicted 799
13 SASI_Hs01_00161098 predicted 896
14 SASI_Hs01_00161100 predicted 996
15 SASI_Hs01_00161102 predicted 1125
16 SASI_Hs01_00161103 predicted 1429
17 SASI_Hs01_00161104 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083772 predicted 217
2 SASI_Rn01_00083774 predicted 640
3 SASI_Rn01_00083775 predicted 572
4 SASI_Rn01_00083776 predicted 466
5 SASI_Rn01_00083777 predicted 970
6 SASI_Rn01_00083778 predicted 742
7 SASI_Rn01_00083779 predicted 474
8 SASI_Rn01_00083780 predicted 237
9 SASI_Rn01_00083781 predicted 895
10 SASI_Rn02_00264173 predicted 836
11 SASI_Rn01_00083773 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195075 predicted 1427
2 SASI_Mm01_00195076 predicted 932
3 SASI_Mm01_00195077 predicted 425
4 SASI_Mm01_00195078 predicted 1166
5 SASI_Mm02_00312386 predicted 980
6 SASI_Mm01_00195079 predicted 969
7 SASI_Mm01_00195081 predicted 766
8 SASI_Mm02_00312387 predicted 764
9 SASI_Mm01_00195082 predicted 634
10 SASI_Mm01_00195083 predicted 775
11 SASI_Mm01_00195080 predicted 505
12 SASI_Mm01_00195084 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004382
CRHR1 MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1348s21c1
Sequence:CCGGGTTCTACTGTTTCCTCAATAGCTCGAGCTATTGAGGAAACAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1095s21c1
Sequence:CCGGTCCTGGTCCTGCTGATCAATTCTCGAGAATTGATCAGCAGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004382.4-1771s21c1
Sequence:CCGGGACATGGGAATGAATTGAAATCTCGAGATTTCAATTCATTCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-480s21c1
Sequence:CCGGTCTATGGTGTCCGCTACAATACTCGAGTATTGTAGCGGACACCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-901s1c1
Sequence:CCGGGCTGCGCAAATGGATGTTCATCTCGAGATGAACATCCATTTGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-985s1c1
Sequence:CCGGCGACAATGAGAAGTGCTGGTTCTCGAGAACCAGCACTTCTCATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-451s1c1
Sequence:CCGGCCGCTACAATACCACAAACAACTCGAGTTGTTTGTGGTATTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004382.2-1993s1c1
Sequence:CCGGGAGACAGAAGTCAGGTGTCATCTCGAGATGACACCTGACTTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004382
CRHR1 MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1348s21c1
Sequence:CCGGGTTCTACTGTTTCCTCAATAGCTCGAGCTATTGAGGAAACAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1095s21c1
Sequence:CCGGTCCTGGTCCTGCTGATCAATTCTCGAGAATTGATCAGCAGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004382.4-1771s21c1
Sequence:CCGGGACATGGGAATGAATTGAAATCTCGAGATTTCAATTCATTCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-480s21c1
Sequence:CCGGTCTATGGTGTCCGCTACAATACTCGAGTATTGTAGCGGACACCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-901s1c1
Sequence:CCGGGCTGCGCAAATGGATGTTCATCTCGAGATGAACATCCATTTGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-985s1c1
Sequence:CCGGCGACAATGAGAAGTGCTGGTTCTCGAGAACCAGCACTTCTCATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-451s1c1
Sequence:CCGGCCGCTACAATACCACAAACAACTCGAGTTGTTTGTGGTATTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004382.2-1993s1c1
Sequence:CCGGGAGACAGAAGTCAGGTGTCATCTCGAGATGACACCTGACTTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004382
CRHR1 MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1348s21c1
Sequence:CCGGGTTCTACTGTTTCCTCAATAGCTCGAGCTATTGAGGAAACAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-1095s21c1
Sequence:CCGGTCCTGGTCCTGCTGATCAATTCTCGAGAATTGATCAGCAGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004382.4-1771s21c1
Sequence:CCGGGACATGGGAATGAATTGAAATCTCGAGATTTCAATTCATTCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004382.4-480s21c1
Sequence:CCGGTCTATGGTGTCCGCTACAATACTCGAGTATTGTAGCGGACACCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-901s1c1
Sequence:CCGGGCTGCGCAAATGGATGTTCATCTCGAGATGAACATCCATTTGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-985s1c1
Sequence:CCGGCGACAATGAGAAGTGCTGGTTCTCGAGAACCAGCACTTCTCATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004382.2-451s1c1
Sequence:CCGGCCGCTACAATACCACAAACAACTCGAGTTGTTTGTGGTATTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004382.2-1993s1c1
Sequence:CCGGGAGACAGAAGTCAGGTGTCATCTCGAGATGACACCTGACTTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007762
CRHR1 MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-868s1c1
Sequence:CCGGCCTGCTGATCAACTTTATCTTCTCGAGAAGATAAAGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-612s1c1
Sequence:CCGGCCTACAACTACTTCCACGTAACTCGAGTTACGTGGAAGTAGTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-256s1c1
Sequence:CCGGCCGCTACAACACCACAAACAACTCGAGTTGTTTGTGGTGTTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-376s1c1
Sequence:CCGGCTACCACATTGCCGTCATCATCTCGAGATGATGACGGCAATGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-1105s1c1
Sequence:CCGGCGTGTCTGTGTTCTATTGTTTCTCGAGAAACAATAGAACACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007762
CRHR1 MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-868s1c1
Sequence:CCGGCCTGCTGATCAACTTTATCTTCTCGAGAAGATAAAGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-612s1c1
Sequence:CCGGCCTACAACTACTTCCACGTAACTCGAGTTACGTGGAAGTAGTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-256s1c1
Sequence:CCGGCCGCTACAACACCACAAACAACTCGAGTTGTTTGTGGTGTTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-376s1c1
Sequence:CCGGCTACCACATTGCCGTCATCATCTCGAGATGATGACGGCAATGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-1105s1c1
Sequence:CCGGCGTGTCTGTGTTCTATTGTTTCTCGAGAAACAATAGAACACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007762
CRHR1 MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-868s1c1
Sequence:CCGGCCTGCTGATCAACTTTATCTTCTCGAGAAGATAAAGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-612s1c1
Sequence:CCGGCCTACAACTACTTCCACGTAACTCGAGTTACGTGGAAGTAGTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-256s1c1
Sequence:CCGGCCGCTACAACACCACAAACAACTCGAGTTGTTTGTGGTGTTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-376s1c1
Sequence:CCGGCTACCACATTGCCGTCATCATCTCGAGATGATGACGGCAATGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007762.1-1105s1c1
Sequence:CCGGCGTGTCTGTGTTCTATTGTTTCTCGAGAAACAATAGAACACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks