EMAIL THIS PAGE TO A FRIEND

CRHR2

corticotropin releasing hormone receptor 2

64 Gene Product Result for
Synonyms: CRF-RB CRF2 CRFR2 HM-CRF
UniProtKB ID: Q13324, O43461, Q4QRJ4, Q99431
Gene ID:
Human(1395) Summary: The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
Mouse(12922) corticotropin releasing hormone receptor 2
Rat(64680) corticotropin releasing hormone receptor 2
sheep(101102228) corticotropin releasing hormone receptor 2
naked mole-rat(101722722) corticotropin releasing hormone receptor 2
domestic guinea pig(100715306) corticotropin releasing hormone receptor 2
chicken(395105) corticotropin releasing hormone receptor 2
Horse(100055029) corticotropin releasing hormone receptor 2
domestic cat(101095242) corticotropin releasing hormone receptor 2
dog(482384) corticotropin releasing hormone receptor 2
cow(521831) corticotropin releasing hormone receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001883 Rosetta Predictions human pricing
NM_022714 Rosetta Predictions rat pricing
NM_009953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014313 predicted 667
2 SASI_Hs01_00014314 predicted 561
3 SASI_Hs01_00014315 predicted 711
4 SASI_Hs01_00014316 predicted 684
5 SASI_Hs01_00014317 predicted 711
6 SASI_Hs01_00014318 predicted 468
7 SASI_Hs01_00014319 predicted 713
8 SASI_Hs01_00014320 predicted 780
9 SASI_Hs02_00332735 predicted 356
10 SASI_Hs02_00332736 predicted 338
11 SASI_Hs01_00014321 predicted 233
12 SASI_Hs01_00014322 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082841 predicted 699
2 SASI_Rn01_00082842 predicted 1168
3 SASI_Rn01_00082843 predicted 1177
4 SASI_Rn01_00082844 predicted 420
5 SASI_Rn02_00263549 predicted 768
6 SASI_Rn01_00082845 predicted 851
7 SASI_Rn01_00082846 predicted 656
8 SASI_Rn01_00082847 predicted 750
9 SASI_Rn01_00082848 predicted 435
10 SASI_Rn02_00263550 predicted 311
11 SASI_Rn01_00082840 predicted 1251
12 SASI_Rn01_00082849 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317515 predicted 1881
2 SASI_Mm01_00066017 predicted 861
3 SASI_Mm01_00066018 predicted 503
4 SASI_Mm01_00066019 predicted 1195
5 SASI_Mm01_00066020 predicted 504
6 SASI_Mm01_00066021 predicted 1873
7 SASI_Mm01_00066022 predicted 964
8 SASI_Mm01_00066023 predicted 505
9 SASI_Mm01_00066024 predicted 1901
10 SASI_Mm01_00066025 predicted 1236
11 SASI_Mm01_00066026 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009953
CRHR2 MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone receptor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-386s1c1
Sequence:CCGGCGAGTACTTCAATGGCATCAACTCGAGTTGATGCCATTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009953.1-2250s1c1
Sequence:CCGGCCACAATTCAAGCAACGAGATCTCGAGATCTCGTTGCTTGAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-522s1c1
Sequence:CCGGCATTACCGAATCGCCCTCATTCTCGAGAATGAGGGCGATTCGGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-915s1c1
Sequence:CCGGGCAGTTGGCAAACTCTACTATCTCGAGATAGTAGAGTTTGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-1196s1c1
Sequence:CCGGCCAGATTGTGTTCATCTACTTCTCGAGAAGTAGATGAACACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-1051s21c1
Sequence:CCGGGGATCCTGATGACGAAGTTACCTCGAGGTAACTTCGTCATCAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-957s21c1
Sequence:CCGAGGCAAGGAAGCTGGTGATTTGCTCGAGCAAATCACCAGCTTCCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009953
CRHR2 MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone receptor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-386s1c1
Sequence:CCGGCGAGTACTTCAATGGCATCAACTCGAGTTGATGCCATTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009953.1-2250s1c1
Sequence:CCGGCCACAATTCAAGCAACGAGATCTCGAGATCTCGTTGCTTGAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-522s1c1
Sequence:CCGGCATTACCGAATCGCCCTCATTCTCGAGAATGAGGGCGATTCGGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-915s1c1
Sequence:CCGGGCAGTTGGCAAACTCTACTATCTCGAGATAGTAGAGTTTGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-1196s1c1
Sequence:CCGGCCAGATTGTGTTCATCTACTTCTCGAGAAGTAGATGAACACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-1051s21c1
Sequence:CCGGGGATCCTGATGACGAAGTTACCTCGAGGTAACTTCGTCATCAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-957s21c1
Sequence:CCGAGGCAAGGAAGCTGGTGATTTGCTCGAGCAAATCACCAGCTTCCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009953
CRHR2 MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone receptor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-386s1c1
Sequence:CCGGCGAGTACTTCAATGGCATCAACTCGAGTTGATGCCATTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009953.1-2250s1c1
Sequence:CCGGCCACAATTCAAGCAACGAGATCTCGAGATCTCGTTGCTTGAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-522s1c1
Sequence:CCGGCATTACCGAATCGCCCTCATTCTCGAGAATGAGGGCGATTCGGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-915s1c1
Sequence:CCGGGCAGTTGGCAAACTCTACTATCTCGAGATAGTAGAGTTTGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009953.1-1196s1c1
Sequence:CCGGCCAGATTGTGTTCATCTACTTCTCGAGAAGTAGATGAACACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-1051s21c1
Sequence:CCGGGGATCCTGATGACGAAGTTACCTCGAGGTAACTTCGTCATCAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009953.3-957s21c1
Sequence:CCGAGGCAAGGAAGCTGGTGATTTGCTCGAGCAAATCACCAGCTTCCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001883
CRHR2 MISSION shRNA Bacterial Glycerol Stock
corticotropin releasing hormone receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-1002s1c1
Sequence:CCGGCCTGTCACAGATCATGTTCATCTCGAGATGAACATGATCTGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-825s1c1
Sequence:CCGGGCTCCTGATCAATTTCGTATTCTCGAGAATACGAAATTGATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-264s1c1
Sequence:CCGGGTGGGCCTCAAAGATCAACTACTCGAGTAGTTGATCTTTGAGGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-480s1c1
Sequence:CCGGCCTGCGAAATGTCATGTGGTTCTCGAGAACCACATGACATTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001883.2-1558s1c1
Sequence:CCGGCCAACACACACAGCTATTTATCTCGAGATAAATAGCTGTGTGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1253s21c1
Sequence:CCGGCAGATCATGTTCATCTATTTCCTCGAGGAAATAGATGAACATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1063s21c1
Sequence:CCGGTCTCGTGCTCCTGATCAATTTCTCGAGAAATTGATCAGGAGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-472s21c1
Sequence:CCGGCCGGAATGCCTATCGAGAATGCTCGAGCATTCTCGATAGGCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001883
CRHR2 MISSION shRNA shRNA Plasmid DNA
corticotropin releasing hormone receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-1002s1c1
Sequence:CCGGCCTGTCACAGATCATGTTCATCTCGAGATGAACATGATCTGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-825s1c1
Sequence:CCGGGCTCCTGATCAATTTCGTATTCTCGAGAATACGAAATTGATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-264s1c1
Sequence:CCGGGTGGGCCTCAAAGATCAACTACTCGAGTAGTTGATCTTTGAGGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-480s1c1
Sequence:CCGGCCTGCGAAATGTCATGTGGTTCTCGAGAACCACATGACATTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001883.2-1558s1c1
Sequence:CCGGCCAACACACACAGCTATTTATCTCGAGATAAATAGCTGTGTGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1253s21c1
Sequence:CCGGCAGATCATGTTCATCTATTTCCTCGAGGAAATAGATGAACATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1063s21c1
Sequence:CCGGTCTCGTGCTCCTGATCAATTTCTCGAGAAATTGATCAGGAGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-472s21c1
Sequence:CCGGCCGGAATGCCTATCGAGAATGCTCGAGCATTCTCGATAGGCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001883
CRHR2 MISSION shRNA Lentiviral Transduction Particles
corticotropin releasing hormone receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-1002s1c1
Sequence:CCGGCCTGTCACAGATCATGTTCATCTCGAGATGAACATGATCTGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-825s1c1
Sequence:CCGGGCTCCTGATCAATTTCGTATTCTCGAGAATACGAAATTGATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-264s1c1
Sequence:CCGGGTGGGCCTCAAAGATCAACTACTCGAGTAGTTGATCTTTGAGGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001883.2-480s1c1
Sequence:CCGGCCTGCGAAATGTCATGTGGTTCTCGAGAACCACATGACATTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001883.2-1558s1c1
Sequence:CCGGCCAACACACACAGCTATTTATCTCGAGATAAATAGCTGTGTGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1253s21c1
Sequence:CCGGCAGATCATGTTCATCTATTTCCTCGAGGAAATAGATGAACATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-1063s21c1
Sequence:CCGGTCTCGTGCTCCTGATCAATTTCTCGAGAAATTGATCAGGAGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001883.3-472s21c1
Sequence:CCGGCCGGAATGCCTATCGAGAATGCTCGAGCATTCTCGATAGGCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks