EMAIL THIS PAGE TO A FRIEND

CRIM1

cysteine rich transmembrane BMP regulator 1 (chordin-like)

Synonyms: CRIM-1 S52
UniProtKB ID: Q9NZV1, Q2M2G4, Q59GH0, Q7LCQ5, Q9H318
Gene ID:
Human(51232) Summary: This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
Mouse(50766) cysteine rich transmembrane BMP regulator 1 (chordin like)
Rat(298744) cysteine rich transmembrane BMP regulator 1 (chordin like)
Zebrafish(404210) cysteine rich transmembrane BMP regulator 1 (chordin like)
cow(506264) cysteine rich transmembrane BMP regulator 1 (chordin-like)
domestic cat(101083508) cysteine rich transmembrane BMP regulator 1 (chordin-like)
dog(475723) cysteine rich transmembrane BMP regulator 1 (chordin-like)
chicken(395067) cysteine rich transmembrane BMP regulator 1 (chordin-like)
sheep(101122183) cysteine rich transmembrane BMP regulator 1 (chordin-like)
Domestic Rabbit(100339965) cysteine rich transmembrane BMP regulator 1 (chordin-like)
domestic guinea pig(100715528) cysteine rich transmembrane BMP regulator 1 (chordin-like)
naked mole-rat(101721302) cysteine rich transmembrane BMP regulator 1 (chordin-like)
226 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1393 Human CRIM1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016441 Rosetta Predictions human pricing
XM_001064272 Rosetta Predictions rat pricing
XM_233798 Rosetta Predictions rat pricing
NM_015800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096104 predicted 2052
2 SASI_Hs02_00349470 predicted 1710
3 SASI_Hs02_00349471 predicted 1041
4 SASI_Hs01_00096107 predicted 3106
5 SASI_Hs02_00349472 predicted 2479
6 SASI_Hs01_00096108 predicted 2676
7 SASI_Hs02_00349473 predicted 963
8 SASI_Hs01_00096109 predicted 2270
9 SASI_Hs01_00096110 predicted 867
10 SASI_Hs02_00349474 predicted 1656
11 SASI_Hs01_00096105 predicted 2942
12 SASI_Hs01_00096106 predicted 509
13 SASI_Hs01_00096111 predicted 858
14 SASI_Hs01_00096112 predicted 2867
15 SASI_Hs01_00096113 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309896 predicted 2511
2 SASI_Rn02_00309897 predicted 2083
3 SASI_Rn02_00309898 predicted 2282
4 SASI_Rn02_00309899 predicted 1630
5 SASI_Rn02_00309900 predicted 1440
6 SASI_Rn02_00309901 predicted 2068
7 SASI_Rn02_00309902 predicted 2562
8 SASI_Rn02_00309903 predicted 3566
9 SASI_Rn02_00309904 predicted 1390
10 SASI_Rn02_00309905 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388040 predicted 2483
2 SASI_Rn02_00388041 predicted 2047
3 SASI_Rn02_00388042 predicted 2252
4 SASI_Rn02_00388043 predicted 1599
5 SASI_Rn02_00388044 predicted 1405
6 SASI_Rn02_00388045 predicted 2039
7 SASI_Rn02_00388046 predicted 2538
8 SASI_Rn02_00388047 predicted 3541
9 SASI_Rn02_00388048 predicted 1361
10 SASI_Rn02_00388049 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058940 predicted 770
2 SASI_Mm01_00058941 predicted 2288
3 SASI_Mm01_00058942 predicted 862
4 SASI_Mm01_00058943 predicted 1334
5 SASI_Mm01_00058944 predicted 1033
6 SASI_Mm01_00058945 predicted 3064
7 SASI_Mm01_00058946 predicted 2643
8 SASI_Mm02_00323170 predicted 835
9 SASI_Mm01_00058947 predicted 2770
10 SASI_Mm01_00058949 predicted 971
11 SASI_Mm01_00058948 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016441
VALIDATED
CRIM1 MISSION shRNA Bacterial Glycerol Stock
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-1046s21c1
Sequence:CCGGGCGTATTTAACAATGTGGAATCTCGAGATTCCACATTGTTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-2405s21c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-709s21c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016441.1-1868s21c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2271s1c1
Sequence:CCGGCCGCAATAACAGCGTACCTAACTCGAGTTAGGTACGCTGTTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2405s1c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-709s1c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016441.1-1868s1c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016441
VALIDATED
CRIM1 MISSION shRNA shRNA Plasmid DNA
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-1046s21c1
Sequence:CCGGGCGTATTTAACAATGTGGAATCTCGAGATTCCACATTGTTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-2405s21c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-709s21c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016441.1-1868s21c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2271s1c1
Sequence:CCGGCCGCAATAACAGCGTACCTAACTCGAGTTAGGTACGCTGTTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2405s1c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-709s1c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016441.1-1868s1c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016441
VALIDATED
CRIM1 MISSION shRNA Lentiviral Transduction Particles
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-1046s21c1
Sequence:CCGGGCGTATTTAACAATGTGGAATCTCGAGATTCCACATTGTTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-2405s21c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016441.1-709s21c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016441.1-1868s21c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2271s1c1
Sequence:CCGGCCGCAATAACAGCGTACCTAACTCGAGTTAGGTACGCTGTTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-2405s1c1
Sequence:CCGGGCCCTTCTGTATCCTGTGAAACTCGAGTTTCACAGGATACAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016441.1-709s1c1
Sequence:CCGGCCGGGAAACCTGAACATACTACTCGAGTAGTATGTTCAGGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016441.1-1868s1c1
Sequence:CCGGCCGTGGATGGTCATCATCATACTCGAGTATGATGATGACCATCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015800
VALIDATED
CRIM1 MISSION shRNA Bacterial Glycerol Stock
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-3152s21c1
Sequence:CCGGTAATATGCCTGTCCATCATAACTCGAGTTATGATGGACAGGCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015800.2-3069s21c1
Sequence:CCGGGGTAGATTACAGAGATAATAACTCGAGTTATTATCTCTGTAATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-2634s21c1
Sequence:CCGGGTGCGTGGATAGCGCAATTAGCTCGAGCTAATTGCGCTATCCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-692s21c1
Sequence:CCGGTCATCTCCGGCTGCAACATAACTCGAGTTATGTTGCAGCCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-1739s21c1
Sequence:CCGGAGGAGAAGGACTGCGTTTATGCTCGAGCATAAACGCAGTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3240s1c1
Sequence:CCGGCAAGCCTTCTTCCTTGAATAACTCGAGTTATTCAAGGAAGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-2145s1c1
Sequence:CCGGCCATCATCATAAGAACGAGGACTCGAGTCCTCGTTCTTATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3066s1c1
Sequence:CCGGCCAGGTAGATTACAGAGATAACTCGAGTTATCTCTGTAATCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015800
VALIDATED
CRIM1 MISSION shRNA shRNA Plasmid DNA
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-3152s21c1
Sequence:CCGGTAATATGCCTGTCCATCATAACTCGAGTTATGATGGACAGGCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015800.2-3069s21c1
Sequence:CCGGGGTAGATTACAGAGATAATAACTCGAGTTATTATCTCTGTAATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-2634s21c1
Sequence:CCGGGTGCGTGGATAGCGCAATTAGCTCGAGCTAATTGCGCTATCCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-692s21c1
Sequence:CCGGTCATCTCCGGCTGCAACATAACTCGAGTTATGTTGCAGCCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-1739s21c1
Sequence:CCGGAGGAGAAGGACTGCGTTTATGCTCGAGCATAAACGCAGTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3240s1c1
Sequence:CCGGCAAGCCTTCTTCCTTGAATAACTCGAGTTATTCAAGGAAGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-2145s1c1
Sequence:CCGGCCATCATCATAAGAACGAGGACTCGAGTCCTCGTTCTTATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3066s1c1
Sequence:CCGGCCAGGTAGATTACAGAGATAACTCGAGTTATCTCTGTAATCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015800
VALIDATED
CRIM1 MISSION shRNA Lentiviral Transduction Particles
cysteine rich transmembrane BMP regulator 1 (chordin-like)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-3152s21c1
Sequence:CCGGTAATATGCCTGTCCATCATAACTCGAGTTATGATGGACAGGCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015800.2-3069s21c1
Sequence:CCGGGGTAGATTACAGAGATAATAACTCGAGTTATTATCTCTGTAATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-2634s21c1
Sequence:CCGGGTGCGTGGATAGCGCAATTAGCTCGAGCTAATTGCGCTATCCACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-692s21c1
Sequence:CCGGTCATCTCCGGCTGCAACATAACTCGAGTTATGTTGCAGCCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015800.2-1739s21c1
Sequence:CCGGAGGAGAAGGACTGCGTTTATGCTCGAGCATAAACGCAGTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3240s1c1
Sequence:CCGGCAAGCCTTCTTCCTTGAATAACTCGAGTTATTCAAGGAAGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-2145s1c1
Sequence:CCGGCCATCATCATAAGAACGAGGACTCGAGTCCTCGTTCTTATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015800.1-3066s1c1
Sequence:CCGGCCAGGTAGATTACAGAGATAACTCGAGTTATCTCTGTAATCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks