EMAIL THIS PAGE TO A FRIEND

CRIP1

cysteine-rich protein 1 (intestinal)

48 Gene Product Result for
Synonyms: CRHP CRIP CRP-1 CRP1
UniProtKB ID: P50238, H3BPI2, Q13628, Q53XY7, Q96J34
Gene ID:
Human(1396) Summary: Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]
Mouse(12925) cysteine-rich protein 1 (intestinal)
Rat(691657) cysteine-rich protein 1 (intestinal)
Zebrafish(541319) cysteine-rich protein 1
cow(574093) cysteine-rich protein 1 (intestinal)
domestic cat(101101478) cysteine-rich protein 1 (intestinal)
dog(612713) cysteine-rich protein 1 (intestinal)
chicken(101747696) cysteine-rich protein 1 (intestinal)
naked mole-rat(101718254) cysteine-rich protein 1 (intestinal)
domestic guinea pig(100716786) cysteine-rich protein 1 (intestinal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001311 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112741 MISSION® esiRNA esiRNA human AL928654.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001311 Rosetta Predictions human pricing
NM_001134933 Rosetta Predictions rat pricing
NM_007763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331596 predicted 239
2 SASI_Hs02_00331597 predicted 237
3 SASI_Hs02_00331598 predicted 239
4 SASI_Hs02_00331599 predicted 238
5 SASI_Hs02_00331600 predicted 203
6 SASI_Hs01_00188592 predicted 181
7 SASI_Hs01_00188593 predicted 322
8 SASI_Hs01_00188594 predicted 323
9 SASI_Hs01_00188595 predicted 324
10 SASI_Hs01_00188597 predicted 272
11 SASI_Hs01_00188591 predicted 217
12 SASI_Hs01_00188596 predicted 223
13 SASI_Hs01_00188598 predicted 128
14 SASI_Hs01_00188599 predicted 261
15 SASI_Hs01_00188600 predicted 93
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259044 predicted 320
2 SASI_Rn02_00259045 predicted 367
3 SASI_Rn02_00259046 predicted 398
4 SASI_Rn02_00259047 predicted 365
5 SASI_Rn02_00259048 predicted 255
6 SASI_Rn02_00259049 predicted 208
7 SASI_Rn02_00259050 predicted 385
8 SASI_Rn02_00259051 predicted 443
9 SASI_Rn02_00259052 predicted 206
10 SASI_Rn02_00259053 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054827 predicted 174
2 SASI_Mm01_00054828 predicted 142
3 SASI_Mm01_00054829 predicted 132
4 SASI_Mm01_00054830 predicted 124
5 SASI_Mm01_00054831 predicted 120
6 SASI_Mm01_00054834 predicted 147
7 SASI_Mm01_00054835 predicted 162
8 SASI_Mm02_00312388 predicted 129
9 SASI_Mm01_00054826 predicted 258
10 SASI_Mm02_00312389 predicted 304
11 SASI_Mm01_00054832 predicted 245
12 SASI_Mm01_00054833 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007763
VALIDATED
CRIP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 1 (intestinal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-140s1c1
Sequence:CCGGCCCTGCCTGAAGTGCGAGAAACTCGAGTTTCTCGCACTTCAGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-101s1c1
Sequence:CCGGGCTGAGCGAGTGACGTCACTACTCGAGTAGTGACGTCACTCGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-248s1c1
Sequence:CCGGCCCAAAGGCTTTGGGCGAGGTCTCGAGACCTCGCCCAAAGCCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-224s1c1
Sequence:CCGGCCCTGCTACTCCGCCATGTTTCTCGAGAAACATGGCGGAGTAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-148s1c1
Sequence:CCGGGAAGTGCGAGAAATGTGGAAACTCGAGTTTCCACATTTCTCGCACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007763
VALIDATED
CRIP1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 1 (intestinal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-140s1c1
Sequence:CCGGCCCTGCCTGAAGTGCGAGAAACTCGAGTTTCTCGCACTTCAGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-101s1c1
Sequence:CCGGGCTGAGCGAGTGACGTCACTACTCGAGTAGTGACGTCACTCGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-248s1c1
Sequence:CCGGCCCAAAGGCTTTGGGCGAGGTCTCGAGACCTCGCCCAAAGCCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-224s1c1
Sequence:CCGGCCCTGCTACTCCGCCATGTTTCTCGAGAAACATGGCGGAGTAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-148s1c1
Sequence:CCGGGAAGTGCGAGAAATGTGGAAACTCGAGTTTCCACATTTCTCGCACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007763
VALIDATED
CRIP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 1 (intestinal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-140s1c1
Sequence:CCGGCCCTGCCTGAAGTGCGAGAAACTCGAGTTTCTCGCACTTCAGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-101s1c1
Sequence:CCGGGCTGAGCGAGTGACGTCACTACTCGAGTAGTGACGTCACTCGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-248s1c1
Sequence:CCGGCCCAAAGGCTTTGGGCGAGGTCTCGAGACCTCGCCCAAAGCCTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007763.1-224s1c1
Sequence:CCGGCCCTGCTACTCCGCCATGTTTCTCGAGAAACATGGCGGAGTAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007763.1-148s1c1
Sequence:CCGGGAAGTGCGAGAAATGTGGAAACTCGAGTTTCCACATTTCTCGCACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001311
VALIDATED
CRIP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 1 (intestinal)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-287s21c1
Sequence:CCGGCAGCCATGTTTGGGCCTAAAGCTCGAGCTTTAGGCCCAAACATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-194s21c1
Sequence:CCGGCCTGCCTGAAGTGCGAGAAATCTCGAGATTTCTCGCACTTCAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-248s21c1
Sequence:CCGGAGCACGAAGGCAAACCCTACTCTCGAGAGTAGGGTTTGCCTTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-210s21c1
Sequence:CCGGGAAATGTGGGAAGACGCTGACCTCGAGGTCAGCGTCTTCCCACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001311.4-278s21c1
Sequence:CCGGCCTGCTACGCAGCCATGTTTGCTCGAGCAAACATGGCTGCGTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001311
VALIDATED
CRIP1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 1 (intestinal)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-287s21c1
Sequence:CCGGCAGCCATGTTTGGGCCTAAAGCTCGAGCTTTAGGCCCAAACATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-194s21c1
Sequence:CCGGCCTGCCTGAAGTGCGAGAAATCTCGAGATTTCTCGCACTTCAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-248s21c1
Sequence:CCGGAGCACGAAGGCAAACCCTACTCTCGAGAGTAGGGTTTGCCTTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-210s21c1
Sequence:CCGGGAAATGTGGGAAGACGCTGACCTCGAGGTCAGCGTCTTCCCACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001311.4-278s21c1
Sequence:CCGGCCTGCTACGCAGCCATGTTTGCTCGAGCAAACATGGCTGCGTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001311
VALIDATED
CRIP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 1 (intestinal)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-287s21c1
Sequence:CCGGCAGCCATGTTTGGGCCTAAAGCTCGAGCTTTAGGCCCAAACATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-194s21c1
Sequence:CCGGCCTGCCTGAAGTGCGAGAAATCTCGAGATTTCTCGCACTTCAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-248s21c1
Sequence:CCGGAGCACGAAGGCAAACCCTACTCTCGAGAGTAGGGTTTGCCTTCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001311.4-210s21c1
Sequence:CCGGGAAATGTGGGAAGACGCTGACCTCGAGGTCAGCGTCTTCCCACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001311.4-278s21c1
Sequence:CCGGCCTGCTACGCAGCCATGTTTGCTCGAGCAAACATGGCTGCGTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)