EMAIL THIS PAGE TO A FRIEND

CRIP2

cysteine-rich protein 2

79 Gene Product Result for
Synonyms: CRIP CRP2 ESP1
UniProtKB ID: P52943, A1A4U1, B7Z6C0, E9PD13
Gene ID:
Human(1397) Summary: This gene encodes a putative transcription factor with two LIM zinc-binding domains. The encoded protein may participate in the differentiation of smooth muscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(68337) cysteine rich protein 2
Rat(338401) cysteine-rich protein 2
Zebrafish(554826) cysteine-rich protein 2
chicken(424374) cysteine-rich protein 2
cow(780821) cysteine-rich protein 2
domestic cat(101090447) cysteine-rich protein 2
dog(612710) cysteine-rich protein 2
domestic guinea pig(100716509) cysteine-rich protein 2
naked mole-rat(101718602) cysteine-rich protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001312 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001312 Rosetta Predictions human pricing
NM_022501 Rosetta Predictions rat pricing
NM_024223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138605 predicted 893
2 SASI_Hs02_00331601 predicted 456
3 SASI_Hs01_00138606 predicted 284
4 SASI_Hs01_00138607 predicted 747
5 SASI_Hs01_00138608 predicted 253
6 SASI_Hs01_00138609 predicted 472
7 SASI_Hs01_00138610 predicted 888
8 SASI_Hs01_00138611 predicted 892
9 SASI_Hs01_00138612 predicted 466
10 SASI_Hs01_00138613 predicted 688
11 SASI_Hs01_00138604 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079957 predicted 242
2 SASI_Rn01_00079958 predicted 796
3 SASI_Rn01_00079959 predicted 828
4 SASI_Rn01_00079960 predicted 789
5 SASI_Rn01_00079961 predicted 268
6 SASI_Rn01_00079962 predicted 851
7 SASI_Rn01_00079963 predicted 648
8 SASI_Rn01_00079964 predicted 319
9 SASI_Rn01_00079965 predicted 210
10 SASI_Rn01_00079966 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076861 predicted 657
2 SASI_Mm01_00076862 predicted 689
3 SASI_Mm02_00327595 predicted 424
4 SASI_Mm01_00076863 predicted 633
5 SASI_Mm01_00076864 predicted 556
6 SASI_Mm01_00076865 predicted 706
7 SASI_Mm01_00076866 predicted 219
8 SASI_Mm01_00076868 predicted 627
9 SASI_Mm01_00076869 predicted 252
10 SASI_Mm01_00076870 predicted 396
11 SASI_Mm01_00076867 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024223
VALIDATED
CRIP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-567s21c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-915s21c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-325s21c1
Sequence:CCGGGTGAGAACTGAGGAGCGAAAGCTCGAGCTTTCGCTCCTCAGTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024223.1-376s21c1
Sequence:CCGGGCCTCTAGTGTCACCACATTCCTCGAGGAATGTGGTGACACTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-69s21c1
Sequence:CCGGGACCGTATACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-592s1c1
Sequence:CCGGCCCAAAGGAGTGAATACTGGTCTCGAGACCAGTATTCACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-567s1c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-66s1c1
Sequence:CCGGCAAGACCGTATACTTCGCTGACTCGAGTCAGCGAAGTATACGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024223.1-915s1c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024223
VALIDATED
CRIP2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-567s21c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-915s21c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-325s21c1
Sequence:CCGGGTGAGAACTGAGGAGCGAAAGCTCGAGCTTTCGCTCCTCAGTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024223.1-376s21c1
Sequence:CCGGGCCTCTAGTGTCACCACATTCCTCGAGGAATGTGGTGACACTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-69s21c1
Sequence:CCGGGACCGTATACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-592s1c1
Sequence:CCGGCCCAAAGGAGTGAATACTGGTCTCGAGACCAGTATTCACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-567s1c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-66s1c1
Sequence:CCGGCAAGACCGTATACTTCGCTGACTCGAGTCAGCGAAGTATACGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024223.1-915s1c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024223
VALIDATED
CRIP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-567s21c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-915s21c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-325s21c1
Sequence:CCGGGTGAGAACTGAGGAGCGAAAGCTCGAGCTTTCGCTCCTCAGTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024223.1-376s21c1
Sequence:CCGGGCCTCTAGTGTCACCACATTCCTCGAGGAATGTGGTGACACTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024223.1-69s21c1
Sequence:CCGGGACCGTATACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-592s1c1
Sequence:CCGGCCCAAAGGAGTGAATACTGGTCTCGAGACCAGTATTCACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-567s1c1
Sequence:CCGGGCCTTGCTATGGAATACTCTTCTCGAGAAGAGTATTCCATAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024223.1-66s1c1
Sequence:CCGGCAAGACCGTATACTTCGCTGACTCGAGTCAGCGAAGTATACGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024223.1-915s1c1
Sequence:CCGGCCAAGGTGACTGTCCTATGATCTCGAGATCATAGGACAGTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001312
VALIDATED
CRIP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-453s21c1
Sequence:CCGGCTGCAGCAAGAAGGTGTACTTCTCGAGAAGTACACCTTCTTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-485s21c1
Sequence:CCGGTGACGTCTCTGGGCAAGGATTCTCGAGAATCCTTGCCCAGAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-1020s21c1
Sequence:CCGGCCACCTGCCAGTGTTATTTATCTCGAGATAAATAACACTGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-287s21c1
Sequence:CCGGGCTCCTACATCTACGAGAAGCCTCGAGGCTTCTCGTAGATGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-598s21c1
Sequence:CCGGCCCTGCTATGGAATCCTCTTCCTCGAGGAAGAGGATTCCATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001312.2-462s1c1
Sequence:CCGGGAAGGTGTACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001312
VALIDATED
CRIP2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-453s21c1
Sequence:CCGGCTGCAGCAAGAAGGTGTACTTCTCGAGAAGTACACCTTCTTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-485s21c1
Sequence:CCGGTGACGTCTCTGGGCAAGGATTCTCGAGAATCCTTGCCCAGAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-1020s21c1
Sequence:CCGGCCACCTGCCAGTGTTATTTATCTCGAGATAAATAACACTGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-287s21c1
Sequence:CCGGGCTCCTACATCTACGAGAAGCCTCGAGGCTTCTCGTAGATGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-598s21c1
Sequence:CCGGCCCTGCTATGGAATCCTCTTCCTCGAGGAAGAGGATTCCATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001312.2-462s1c1
Sequence:CCGGGAAGGTGTACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001312
VALIDATED
CRIP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-453s21c1
Sequence:CCGGCTGCAGCAAGAAGGTGTACTTCTCGAGAAGTACACCTTCTTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-485s21c1
Sequence:CCGGTGACGTCTCTGGGCAAGGATTCTCGAGAATCCTTGCCCAGAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-1020s21c1
Sequence:CCGGCCACCTGCCAGTGTTATTTATCTCGAGATAAATAACACTGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-287s21c1
Sequence:CCGGGCTCCTACATCTACGAGAAGCCTCGAGGCTTCTCGTAGATGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001312.2-598s21c1
Sequence:CCGGCCCTGCTATGGAATCCTCTTCCTCGAGGAAGAGGATTCCATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001312.2-462s1c1
Sequence:CCGGGAAGGTGTACTTCGCTGAGAACTCGAGTTCTCAGCGAAGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks