EMAIL THIS PAGE TO A FRIEND

CRIP3

cysteine-rich protein 3

85 Gene Product Result for
Synonyms: TLP TLP-A bA480N24.2
UniProtKB ID: Q6Q6R5, A2A436, Q5T043, Q6Q6R4, Q6Q6R6, Q6Q6R7
Gene ID:
Mouse(114570) cysteine-rich protein 3
Rat(501100) cysteine-rich protein 3
naked mole-rat(101716939) cysteine-rich protein 3
domestic guinea pig(100734275) cysteine-rich protein 3
sheep(101114314) cysteine-rich protein 3
dog(481812) cysteine-rich protein 3
cow(530071) cysteine-rich protein 3
domestic cat(101086562) cysteine-rich protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144251 MISSION® esiRNA esiRNA human CRIP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206922 Rosetta Predictions human pricing
NM_001109303 Rosetta Predictions rat pricing
NM_053250 Rosetta Predictions mouse pricing
NM_181664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373617 predicted 473
2 SASI_Hs02_00373618 predicted 658
3 SASI_Hs02_00373619 predicted 565
4 SASI_Hs02_00373620 predicted 564
5 SASI_Hs02_00373621 predicted 468
6 SASI_Hs02_00373622 predicted 462
7 SASI_Hs02_00373623 predicted 665
8 SASI_Hs02_00373624 predicted 732
9 SASI_Hs02_00373625 predicted 402
10 SASI_Hs02_00373626 predicted 733
11 SASI_Hs01_00098927 predicted 404
12 SASI_Hs01_00098928 predicted 216
13 SASI_Hs01_00098929 predicted 213
14 SASI_Hs01_00098930 predicted 407
15 SASI_Hs01_00098931 predicted 208
16 SASI_Hs01_00098932 predicted 214
17 SASI_Hs01_00098933 predicted 359
18 SASI_Hs01_00098934 predicted 407
19 SASI_Hs01_00098935 predicted 409
20 SASI_Hs01_00098936 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247094 predicted 467
2 SASI_Rn02_00247095 predicted 495
3 SASI_Rn02_00247096 predicted 569
4 SASI_Rn02_00247097 predicted 573
5 SASI_Rn02_00247098 predicted 397
6 SASI_Rn02_00247099 predicted 449
7 SASI_Rn02_00247100 predicted 330
8 SASI_Rn02_00247101 predicted 530
9 SASI_Rn02_00247102 predicted 486
10 SASI_Rn02_00247103 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337854 predicted 335
2 SASI_Mm02_00337855 predicted 213
3 SASI_Mm02_00337856 predicted 336
4 SASI_Mm01_00061113 predicted 334
5 SASI_Mm02_00337857 predicted 335
6 SASI_Mm02_00337858 predicted 313
7 SASI_Mm02_00337859 predicted 330
8 SASI_Mm02_00337860 predicted 217
9 SASI_Mm02_00337861 predicted 210
10 SASI_Mm02_00337862 predicted 220
11 SASI_Mm01_00061108 predicted 359
12 SASI_Mm01_00061109 predicted 692
13 SASI_Mm01_00061110 predicted 405
14 SASI_Mm01_00061111 predicted 687
15 SASI_Mm01_00061112 predicted 685
16 SASI_Mm01_00061114 predicted 689
17 SASI_Mm01_00061115 predicted 650
18 SASI_Mm01_00061116 predicted 507
19 SASI_Mm01_00061117 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176167 predicted 329
2 SASI_Mm01_00176168 predicted 217
3 SASI_Mm01_00176169 predicted 327
4 SASI_Mm01_00176170 predicted 337
5 SASI_Mm01_00176171 predicted 333
6 SASI_Mm01_00176172 predicted 315
7 SASI_Mm01_00176173 predicted 333
8 SASI_Mm01_00176174 predicted 223
9 SASI_Mm01_00176175 predicted 215
10 SASI_Mm01_00176176 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206922
CRIP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-400s1c1
Sequence:CCGGGCTGAGAAAGTGATGTCATTACTCGAGTAATGACATCACTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-405s1c1
Sequence:CCGGGAAAGTGATGTCATTAAGCAGCTCGAGCTGCTTAATGACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206922.2-754s21c1
Sequence:CCGGGGCCAGAGAGTCTAGACTTTCCTCGAGGAAAGTCTAGACTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-409s21c1
Sequence:CCGGGTGATGTCATTAGGCAGAAATCTCGAGATTTCTGCCTAATGACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-584s21c1
Sequence:CCGGTCTATGACCCAGTGAAGATAACTCGAGTTATCTTCACTGGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-215s21c1
Sequence:CCGGTAGGCTCCTACTTGTACAATCCTCGAGGATTGTACAAGTAGGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-76s21c1
Sequence:CCGGCACCGCTTCTGCCTGAAATGTCTCGAGACATTTCAGGCAGAAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206922
CRIP3 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-400s1c1
Sequence:CCGGGCTGAGAAAGTGATGTCATTACTCGAGTAATGACATCACTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-405s1c1
Sequence:CCGGGAAAGTGATGTCATTAAGCAGCTCGAGCTGCTTAATGACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206922.2-754s21c1
Sequence:CCGGGGCCAGAGAGTCTAGACTTTCCTCGAGGAAAGTCTAGACTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-409s21c1
Sequence:CCGGGTGATGTCATTAGGCAGAAATCTCGAGATTTCTGCCTAATGACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-584s21c1
Sequence:CCGGTCTATGACCCAGTGAAGATAACTCGAGTTATCTTCACTGGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-215s21c1
Sequence:CCGGTAGGCTCCTACTTGTACAATCCTCGAGGATTGTACAAGTAGGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-76s21c1
Sequence:CCGGCACCGCTTCTGCCTGAAATGTCTCGAGACATTTCAGGCAGAAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206922
CRIP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-400s1c1
Sequence:CCGGGCTGAGAAAGTGATGTCATTACTCGAGTAATGACATCACTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206922.1-405s1c1
Sequence:CCGGGAAAGTGATGTCATTAAGCAGCTCGAGCTGCTTAATGACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206922.2-754s21c1
Sequence:CCGGGGCCAGAGAGTCTAGACTTTCCTCGAGGAAAGTCTAGACTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-409s21c1
Sequence:CCGGGTGATGTCATTAGGCAGAAATCTCGAGATTTCTGCCTAATGACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-584s21c1
Sequence:CCGGTCTATGACCCAGTGAAGATAACTCGAGTTATCTTCACTGGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-215s21c1
Sequence:CCGGTAGGCTCCTACTTGTACAATCCTCGAGGATTGTACAAGTAGGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206922.2-76s21c1
Sequence:CCGGCACCGCTTCTGCCTGAAATGTCTCGAGACATTTCAGGCAGAAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181664
CRIP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181664.1-632s1c1
Sequence:CCGGGCAGGAGTGATTAACCTAACTCTCGAGAGTTAGGTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-230s1c1
Sequence:CCGGGCTATCTCTACAACCTCCCAACTCGAGTTGGGAGGTTGTAGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-339s1c1
Sequence:CCGGGCCTCCCTACTTGAAGACATTCTCGAGAATGTCTTCAAGTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-602s1c1
Sequence:CCGGCAGTGGACATAAGATCCAAATCTCGAGATTTGGATCTTATGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-153s1c1
Sequence:CCGGCGGGAGACCATACTGCCACAACTCGAGTTGTGGCAGTATGGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181664
CRIP3 MISSION shRNA shRNA Plasmid DNA
cysteine-rich protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181664.1-632s1c1
Sequence:CCGGGCAGGAGTGATTAACCTAACTCTCGAGAGTTAGGTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-230s1c1
Sequence:CCGGGCTATCTCTACAACCTCCCAACTCGAGTTGGGAGGTTGTAGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-339s1c1
Sequence:CCGGGCCTCCCTACTTGAAGACATTCTCGAGAATGTCTTCAAGTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-602s1c1
Sequence:CCGGCAGTGGACATAAGATCCAAATCTCGAGATTTGGATCTTATGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-153s1c1
Sequence:CCGGCGGGAGACCATACTGCCACAACTCGAGTTGTGGCAGTATGGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181664
CRIP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181664.1-632s1c1
Sequence:CCGGGCAGGAGTGATTAACCTAACTCTCGAGAGTTAGGTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-230s1c1
Sequence:CCGGGCTATCTCTACAACCTCCCAACTCGAGTTGGGAGGTTGTAGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-339s1c1
Sequence:CCGGGCCTCCCTACTTGAAGACATTCTCGAGAATGTCTTCAAGTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-602s1c1
Sequence:CCGGCAGTGGACATAAGATCCAAATCTCGAGATTTGGATCTTATGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181664.1-153s1c1
Sequence:CCGGCGGGAGACCATACTGCCACAACTCGAGTTGTGGCAGTATGGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks