EMAIL THIS PAGE TO A FRIEND

CRIPAK

cysteine-rich PAK1 inhibitor

14 Gene Product Result for
Species: Human CRIPAK(285464)
UniProtKB ID: Q8N1N5, Q8NB03
Gene ID:
Human(285464) Summary: CRIPAK is a negative regulator of PAK1 (MIM 602590) that is upregulated by estrogen (Talukder et al., 2006 [PubMed 16278681]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048960 predicted 4143
2 SASI_Hs01_00048961 predicted 3891
3 SASI_Hs01_00048962 predicted 3515
4 SASI_Hs01_00048963 predicted 4202
5 SASI_Hs02_00369174 predicted 4208
6 SASI_Hs01_00048964 predicted 3592
7 SASI_Hs01_00048965 predicted 4157
8 SASI_Hs01_00048967 predicted 3701
9 SASI_Hs01_00048968 predicted 3273
10 SASI_Hs02_00369175 predicted 3595
11 SASI_Hs01_00048966 predicted 698
12 SASI_Hs01_00048969 predicted 1674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175918
CRIPAK MISSION shRNA Bacterial Glycerol Stock
cysteine-rich PAK1 inhibitor
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-3954s21c1
Sequence:CCGGTGCTCACACACATGCCGATGTCTCGAGACATCGGCATGTGTGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4205s21c1
Sequence:CCGGAGACGCTGTTACCGTACATTCCTCGAGGAATGTACGGTAACAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4288s21c1
Sequence:CCGGTCGAGATAACGTAGGAATATTCTCGAGAATATTCCTACGTTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4166s21c1
Sequence:CCGGATGGTGGTTCTGTAGGTTTCCCTCGAGGGAAACCTACAGAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175918
CRIPAK MISSION shRNA shRNA Plasmid DNA
cysteine-rich PAK1 inhibitor
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-3954s21c1
Sequence:CCGGTGCTCACACACATGCCGATGTCTCGAGACATCGGCATGTGTGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4205s21c1
Sequence:CCGGAGACGCTGTTACCGTACATTCCTCGAGGAATGTACGGTAACAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4288s21c1
Sequence:CCGGTCGAGATAACGTAGGAATATTCTCGAGAATATTCCTACGTTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4166s21c1
Sequence:CCGGATGGTGGTTCTGTAGGTTTCCCTCGAGGGAAACCTACAGAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175918
CRIPAK MISSION shRNA Lentiviral Transduction Particles
cysteine-rich PAK1 inhibitor
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-3954s21c1
Sequence:CCGGTGCTCACACACATGCCGATGTCTCGAGACATCGGCATGTGTGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4205s21c1
Sequence:CCGGAGACGCTGTTACCGTACATTCCTCGAGGAATGTACGGTAACAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4288s21c1
Sequence:CCGGTCGAGATAACGTAGGAATATTCTCGAGAATATTCCTACGTTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175918.3-4166s21c1
Sequence:CCGGATGGTGGTTCTGTAGGTTTCCCTCGAGGGAAACCTACAGAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks