EMAIL THIS PAGE TO A FRIEND

CRIPT

cysteine-rich PDZ-binding protein

UniProtKB ID: Q9P021
Gene ID:
Mouse(56724) cysteine-rich PDZ-binding protein
Rat(56725) cysteine-rich PDZ-binding protein
Zebrafish(550592) cysteine-rich PDZ-binding protein
chicken(421412) cysteine-rich PDZ-binding protein
cow(617723) cysteine-rich PDZ-binding protein
domestic cat(101080272) cysteine-rich PDZ-binding protein
dog(609976) cysteine-rich PDZ-binding protein
sheep(101109344) cysteine-rich PDZ-binding protein
domestic guinea pig(100722644) cysteine-rich PDZ-binding protein
naked mole-rat(101702364) cysteine-rich PDZ-binding protein
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014171 Rosetta Predictions human pricing
NM_019907 Rosetta Predictions rat pricing
NM_019936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098657 predicted 887
2 SASI_Hs01_00098659 predicted 567
3 SASI_Hs01_00098660 predicted 306
4 SASI_Hs02_00345178 predicted 907
5 SASI_Hs01_00098661 predicted 660
6 SASI_Hs01_00098662 predicted 856
7 SASI_Hs01_00098663 predicted 405
8 SASI_Hs01_00098664 predicted 810
9 SASI_Hs01_00098665 predicted 407
10 SASI_Hs01_00098666 predicted 779
11 SASI_Hs01_00098658 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106080 predicted 682
2 SASI_Rn01_00106081 predicted 823
3 SASI_Rn01_00106082 predicted 522
4 SASI_Rn01_00106083 predicted 483
5 SASI_Rn02_00262444 predicted 575
6 SASI_Rn01_00106084 predicted 728
7 SASI_Rn01_00106085 predicted 672
8 SASI_Rn02_00262445 predicted 485
9 SASI_Rn01_00106087 predicted 671
10 SASI_Rn01_00106088 predicted 378
11 SASI_Rn01_00106086 predicted 447
12 SASI_Rn01_00106089 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072651 predicted 769
2 SASI_Mm01_00072652 predicted 674
3 SASI_Mm01_00072653 predicted 728
4 SASI_Mm02_00325230 predicted 595
5 SASI_Mm01_00072654 predicted 390
6 SASI_Mm01_00072655 predicted 592
7 SASI_Mm01_00072656 predicted 385
8 SASI_Mm01_00072657 predicted 401
9 SASI_Mm01_00072658 predicted 664
10 SASI_Mm02_00325231 predicted 672
11 SASI_Mm01_00072650 predicted 768
12 SASI_Mm01_00072659 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019936
CRIPT MISSION shRNA Bacterial Glycerol Stock
cysteine-rich PDZ-binding protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.2-356s1c1
Sequence:CCGGCAGACTTCCGTGTAGATATATCTCGAGATATATCTACACGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.1-99s1c1
Sequence:CCGGGAGTTATCACTCCAGACACATCTCGAGATGTGTCTGGAGTGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019936.1-653s1c1
Sequence:CCGGCGCACTGTCTACTCAACATTACTCGAGTAATGTTGAGTAGACAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-198s1c1
Sequence:CCGGCAAGGTTTGATCCATATGGAACTCGAGTTCCATATGGATCAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-813s1c1
Sequence:CCGGGCACCTTAGTTAAGTGCATTTCTCGAGAAATGCACTTAACTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-413s1c1
Sequence:CCGGGCTTCAACTATTCAAGGCATACTCGAGTATGCCTTGAATAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-266s1c1
Sequence:CCGGCCAGGTTCTCATTACTGTCAACTCGAGTTGACAGTAATGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019936
CRIPT MISSION shRNA shRNA Plasmid DNA
cysteine-rich PDZ-binding protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.2-356s1c1
Sequence:CCGGCAGACTTCCGTGTAGATATATCTCGAGATATATCTACACGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.1-99s1c1
Sequence:CCGGGAGTTATCACTCCAGACACATCTCGAGATGTGTCTGGAGTGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019936.1-653s1c1
Sequence:CCGGCGCACTGTCTACTCAACATTACTCGAGTAATGTTGAGTAGACAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-198s1c1
Sequence:CCGGCAAGGTTTGATCCATATGGAACTCGAGTTCCATATGGATCAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-813s1c1
Sequence:CCGGGCACCTTAGTTAAGTGCATTTCTCGAGAAATGCACTTAACTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-413s1c1
Sequence:CCGGGCTTCAACTATTCAAGGCATACTCGAGTATGCCTTGAATAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-266s1c1
Sequence:CCGGCCAGGTTCTCATTACTGTCAACTCGAGTTGACAGTAATGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019936
CRIPT MISSION shRNA Lentiviral Transduction Particles
cysteine-rich PDZ-binding protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.2-356s1c1
Sequence:CCGGCAGACTTCCGTGTAGATATATCTCGAGATATATCTACACGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019936.1-99s1c1
Sequence:CCGGGAGTTATCACTCCAGACACATCTCGAGATGTGTCTGGAGTGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019936.1-653s1c1
Sequence:CCGGCGCACTGTCTACTCAACATTACTCGAGTAATGTTGAGTAGACAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-198s1c1
Sequence:CCGGCAAGGTTTGATCCATATGGAACTCGAGTTCCATATGGATCAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-813s1c1
Sequence:CCGGGCACCTTAGTTAAGTGCATTTCTCGAGAAATGCACTTAACTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019936.1-413s1c1
Sequence:CCGGGCTTCAACTATTCAAGGCATACTCGAGTATGCCTTGAATAGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019936.1-266s1c1
Sequence:CCGGCCAGGTTCTCATTACTGTCAACTCGAGTTGACAGTAATGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014171
CRIPT MISSION shRNA Bacterial Glycerol Stock
cysteine-rich PDZ-binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-200s1c1
Sequence:CCGGGTGGTGGAAGAAAGCTGAATGCTCGAGCATTCAGCTTTCTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-357s1c1
Sequence:CCGGCATCTGTGCGATGTGTGGAAACTCGAGTTTCCACACATCGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-163s1c1
Sequence:CCGGGATACATGGAAAGATGGTGCTCTCGAGAGCACCATCTTTCCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c2
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014171.3-844s1c1
Sequence:CCGGCCTCTTAACTAATTGCGGTTTCTCGAGAAACCGCAATTAGTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-146s1c1
Sequence:CCGGGTACTGTTATCACTCCAGATACTCGAGTATCTGGAGTGATAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c1
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-248s1c1
Sequence:CCGGCAAGATTTGATCCATATGGAACTCGAGTTCCATATGGATCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014171
CRIPT MISSION shRNA shRNA Plasmid DNA
cysteine-rich PDZ-binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-200s1c1
Sequence:CCGGGTGGTGGAAGAAAGCTGAATGCTCGAGCATTCAGCTTTCTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-357s1c1
Sequence:CCGGCATCTGTGCGATGTGTGGAAACTCGAGTTTCCACACATCGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-163s1c1
Sequence:CCGGGATACATGGAAAGATGGTGCTCTCGAGAGCACCATCTTTCCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c2
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014171.3-844s1c1
Sequence:CCGGCCTCTTAACTAATTGCGGTTTCTCGAGAAACCGCAATTAGTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-146s1c1
Sequence:CCGGGTACTGTTATCACTCCAGATACTCGAGTATCTGGAGTGATAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c1
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-248s1c1
Sequence:CCGGCAAGATTTGATCCATATGGAACTCGAGTTCCATATGGATCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014171
CRIPT MISSION shRNA Lentiviral Transduction Particles
cysteine-rich PDZ-binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-200s1c1
Sequence:CCGGGTGGTGGAAGAAAGCTGAATGCTCGAGCATTCAGCTTTCTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-357s1c1
Sequence:CCGGCATCTGTGCGATGTGTGGAAACTCGAGTTTCCACACATCGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-163s1c1
Sequence:CCGGGATACATGGAAAGATGGTGCTCTCGAGAGCACCATCTTTCCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c2
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014171.3-844s1c1
Sequence:CCGGCCTCTTAACTAATTGCGGTTTCTCGAGAAACCGCAATTAGTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-146s1c1
Sequence:CCGGGTACTGTTATCACTCCAGATACTCGAGTATCTGGAGTGATAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-399s1c1
Sequence:CCGGCTACAAGCAAACATCTGTCTACTCGAGTAGACAGATGTTTGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014171.3-248s1c1
Sequence:CCGGCAAGATTTGATCCATATGGAACTCGAGTTCCATATGGATCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks