EMAIL THIS PAGE TO A FRIEND

CRISP1

cysteine-rich secretory protein 1

Synonyms: AEGL1 ARP CRISP-1 HSCRISP1D HSCRISP1G HUMARP
UniProtKB ID: P54107, B5BU98, O00698, Q13248, Q14082, Q96SF6
Gene ID:
Human(167) Summary: Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(11571) cysteine-rich secretory protein 1
Rat(64827) cysteine-rich secretory protein 1
Goat(100860898) cysteine-rich secretory protein 1
sheep(101102939) cysteine-rich secretory protein 1
cow(616774) cysteine-rich secretory protein 1
Horse(100033953) cysteine-rich secretory protein 1
dog(610137) cysteine-rich secretory protein 1
domestic cat(101082060) cysteine-rich secretory protein 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001131 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001131 Rosetta Predictions human pricing
NM_170609 Rosetta Predictions human pricing
NM_022859 Rosetta Predictions rat pricing
NM_009638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102967 predicted 391
2 SASI_Hs01_00102968 predicted 1123
3 SASI_Hs01_00102969 predicted 1213
4 SASI_Hs01_00102970 predicted 963
5 SASI_Hs01_00102971 predicted 1275
6 SASI_Hs01_00102972 predicted 1073
7 SASI_Hs02_00331218 predicted 1071
8 SASI_Hs01_00102974 predicted 1202
9 SASI_Hs01_00102975 predicted 1087
10 SASI_Hs01_00102976 predicted 951
11 SASI_Hs01_00102973 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247514 predicted 928
2 SASI_Hs01_00247515 predicted 391
3 SASI_Hs01_00247517 predicted 942
4 SASI_Hs01_00247518 predicted 1034
5 SASI_Hs01_00247519 predicted 270
6 SASI_Hs01_00247520 predicted 1000
7 SASI_Hs01_00247521 predicted 879
8 SASI_Hs01_00247522 predicted 986
9 SASI_Hs02_00367562 predicted 975
10 SASI_Hs02_00367563 predicted 1111
11 SASI_Hs01_00247516 predicted 879
12 SASI_Hs01_00247523 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052838 predicted 511
2 SASI_Rn01_00052839 predicted 719
3 SASI_Rn01_00052840 predicted 347
4 SASI_Rn01_00052841 predicted 893
5 SASI_Rn01_00052842 predicted 637
6 SASI_Rn01_00052843 predicted 619
7 SASI_Rn01_00052844 predicted 208
8 SASI_Rn01_00052845 predicted 749
9 SASI_Rn02_00263590 predicted 354
10 SASI_Rn01_00052846 predicted 727
11 SASI_Rn01_00052847 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033514 predicted 721
2 SASI_Mm01_00033515 predicted 416
3 SASI_Mm01_00033516 predicted 807
4 SASI_Mm01_00033517 predicted 559
5 SASI_Mm02_00316604 predicted 657
6 SASI_Mm01_00033518 predicted 559
7 SASI_Mm01_00033519 predicted 593
8 SASI_Mm01_00033520 predicted 811
9 SASI_Mm01_00033521 predicted 574
10 SASI_Mm01_00033522 predicted 591
11 SASI_Mm01_00033523 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009638
VALIDATED
CRISP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-655s1c1
Sequence:CCGGGTGGACATGAAGATAAGTATACTCGAGTATACTTATCTTCATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-432s1c1
Sequence:CCGGCCTGATAGTGTGGTCGGACATCTCGAGATGTCCGACCACACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-840s1c1
Sequence:CCGGCCCACCAAGAAAGTATAGATTCTCGAGAATCTATACTTTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-435s1c1
Sequence:CCGGGATAGTGTGGTCGGACATTATCTCGAGATAATGTCCGACCACACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009638
VALIDATED
CRISP1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-655s1c1
Sequence:CCGGGTGGACATGAAGATAAGTATACTCGAGTATACTTATCTTCATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-432s1c1
Sequence:CCGGCCTGATAGTGTGGTCGGACATCTCGAGATGTCCGACCACACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-840s1c1
Sequence:CCGGCCCACCAAGAAAGTATAGATTCTCGAGAATCTATACTTTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-435s1c1
Sequence:CCGGGATAGTGTGGTCGGACATTATCTCGAGATAATGTCCGACCACACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009638
VALIDATED
CRISP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-655s1c1
Sequence:CCGGGTGGACATGAAGATAAGTATACTCGAGTATACTTATCTTCATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-432s1c1
Sequence:CCGGCCTGATAGTGTGGTCGGACATCTCGAGATGTCCGACCACACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-840s1c1
Sequence:CCGGCCCACCAAGAAAGTATAGATTCTCGAGAATCTATACTTTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009638.2-435s1c1
Sequence:CCGGGATAGTGTGGTCGGACATTATCTCGAGATAATGTCCGACCACACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001131
CRISP1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-346s1c1
Sequence:CCGGCCTTGAGAGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001131.2-1108s1c1
Sequence:CCGGCTCAACAGTAACCTGGGCTAACTCGAGTTAGCCCAGGTTACTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-404s1c1
Sequence:CCGGCCTGTATCATGGTCAAGTGTACTCGAGTACACTTGACCATGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1281s1c1
Sequence:CCGGGCAAACAGAGTTCAGTCTCATCTCGAGATGAGACTGAACTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1200s1c1
Sequence:CCGGGCACAACTAACATCCAGTAATCTCGAGATTACTGGATGTTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-674s1c1
Sequence:CCGGCCAAGTAACTGTGAAGACAAACTCGAGTTTGTCTTCACAGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-566s1c1
Sequence:CCGGCAACAAGGATCACCTCGATATCTCGAGATATCGAGGTGATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-961s1c1
Sequence:CCGGCCCATCCTGATACATCCTGAACTCGAGTTCAGGATGTATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-151s21c1
Sequence:CCGGATCAGCTAGAGACCAATTTAACTCGAGTTAAATTGGTCTCTAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-626s21c1
Sequence:CCGGGAAACAAAGAATGAACCTTATCTCGAGATAAGGTTCATTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001131
CRISP1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-346s1c1
Sequence:CCGGCCTTGAGAGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001131.2-1108s1c1
Sequence:CCGGCTCAACAGTAACCTGGGCTAACTCGAGTTAGCCCAGGTTACTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-404s1c1
Sequence:CCGGCCTGTATCATGGTCAAGTGTACTCGAGTACACTTGACCATGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1281s1c1
Sequence:CCGGGCAAACAGAGTTCAGTCTCATCTCGAGATGAGACTGAACTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1200s1c1
Sequence:CCGGGCACAACTAACATCCAGTAATCTCGAGATTACTGGATGTTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-674s1c1
Sequence:CCGGCCAAGTAACTGTGAAGACAAACTCGAGTTTGTCTTCACAGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-566s1c1
Sequence:CCGGCAACAAGGATCACCTCGATATCTCGAGATATCGAGGTGATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-961s1c1
Sequence:CCGGCCCATCCTGATACATCCTGAACTCGAGTTCAGGATGTATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-151s21c1
Sequence:CCGGATCAGCTAGAGACCAATTTAACTCGAGTTAAATTGGTCTCTAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-626s21c1
Sequence:CCGGGAAACAAAGAATGAACCTTATCTCGAGATAAGGTTCATTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001131
CRISP1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-346s1c1
Sequence:CCGGCCTTGAGAGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001131.2-1108s1c1
Sequence:CCGGCTCAACAGTAACCTGGGCTAACTCGAGTTAGCCCAGGTTACTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001131.2-404s1c1
Sequence:CCGGCCTGTATCATGGTCAAGTGTACTCGAGTACACTTGACCATGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1281s1c1
Sequence:CCGGGCAAACAGAGTTCAGTCTCATCTCGAGATGAGACTGAACTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-1200s1c1
Sequence:CCGGGCACAACTAACATCCAGTAATCTCGAGATTACTGGATGTTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-674s1c1
Sequence:CCGGCCAAGTAACTGTGAAGACAAACTCGAGTTTGTCTTCACAGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001131.2-566s1c1
Sequence:CCGGCAACAAGGATCACCTCGATATCTCGAGATATCGAGGTGATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001131.2-961s1c1
Sequence:CCGGCCCATCCTGATACATCCTGAACTCGAGTTCAGGATGTATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-151s21c1
Sequence:CCGGATCAGCTAGAGACCAATTTAACTCGAGTTAAATTGGTCTCTAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001131.2-626s21c1
Sequence:CCGGGAAACAAAGAATGAACCTTATCTCGAGATAAGGTTCATTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks