EMAIL THIS PAGE TO A FRIEND

CRISP2

cysteine-rich secretory protein 2

80 Gene Product Result for
Synonyms: CRISP-2 CT36 GAPDL5 TPX1 TSP1
UniProtKB ID: P16562
Gene ID:
Mouse(22024) cysteine-rich secretory protein 2
Rat(360445) cysteine-rich secretory protein 2
chicken(422045) cysteine-rich secretory protein 2
dog(474932) cysteine-rich secretory protein 2
cow(512443) cysteine-rich secretory protein 2
Horse(100034138) cysteine-rich secretory protein 2
Goat(100860897) cysteine-rich secretory protein 2
sheep(101102271) cysteine-rich secretory protein 2
sheep(100462690) cysteine-rich secretory protein 2
domestic guinea pig(100135505) cysteine-rich secretory protein 2
naked mole-rat(101697420) cysteine-rich secretory protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1394 Human CRISP-2 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0794 AQUA Peptide GCPDDITVMVV[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065041 MISSION® esiRNA esiRNA human CRISP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003296 Rosetta Predictions human pricing
NM_001011710 Rosetta Predictions rat pricing
XM_576523 Rosetta Predictions rat pricing
NM_009420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185973 predicted 995
2 SASI_Hs01_00185974 predicted 969
3 SASI_Hs01_00185975 predicted 841
4 SASI_Hs01_00185976 predicted 575
5 SASI_Hs01_00185977 predicted 1033
6 SASI_Hs01_00185978 predicted 653
7 SASI_Hs01_00185979 predicted 636
8 SASI_Hs01_00185981 predicted 418
9 SASI_Hs01_00185982 predicted 854
10 SASI_Hs02_00335387 predicted 906
11 SASI_Hs01_00185980 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199851 predicted 548
2 SASI_Rn02_00199852 predicted 473
3 SASI_Rn02_00199853 predicted 573
4 SASI_Rn01_00105363 predicted 450
5 SASI_Rn01_00105366 predicted 405
6 SASI_Rn02_00199854 predicted 469
7 SASI_Rn02_00199855 predicted 479
8 SASI_Rn02_00199856 predicted 492
9 SASI_Rn02_00199857 predicted 555
10 SASI_Rn02_00199858 predicted 562
11 SASI_Rn01_00105357 predicted 278
12 SASI_Rn01_00105358 predicted 970
13 SASI_Rn01_00105359 predicted 820
14 SASI_Rn01_00105360 predicted 362
15 SASI_Rn01_00105361 predicted 667
16 SASI_Rn01_00105362 predicted 305
17 SASI_Rn01_00105364 predicted 247
18 SASI_Rn01_00105365 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136847 predicted 270
2 SASI_Rn01_00136848 predicted 225
3 SASI_Rn01_00136849 predicted 346
4 SASI_Rn01_00136850 predicted 227
5 SASI_Rn01_00136851 predicted 207
6 SASI_Rn01_00136852 predicted 297
7 SASI_Rn01_00136853 predicted 234
8 SASI_Rn01_00136854 predicted 267
9 SASI_Rn01_00136855 predicted 262
10 SASI_Rn01_00136856 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316077 predicted 676
2 SASI_Mm01_00184811 predicted 983
3 SASI_Mm01_00184812 predicted 594
4 SASI_Mm01_00184814 predicted 704
5 SASI_Mm01_00184815 predicted 328
6 SASI_Mm01_00184816 predicted 278
7 SASI_Mm01_00184817 predicted 461
8 SASI_Mm01_00184818 predicted 762
9 SASI_Mm01_00184819 predicted 613
10 SASI_Mm01_00184820 predicted 720
11 SASI_Mm01_00184813 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003296
CRISP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003296.2-1025s21c1
Sequence:CCGGTGGATAAGGGCTGCATCATTTCTCGAGAAATGATGCAGCCCTTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-852s21c1
Sequence:CCGGACAAAGGACTATGCACCAATACTCGAGTATTGGTGCATAGTCCTTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-775s21c1
Sequence:CCGGTGCTGGTAATAATATGAATAGCTCGAGCTATTCATATTATTACCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-704s1c1
Sequence:CCGGGTCCCAATCAAGATAGTCTAACTCGAGTTAGACTATCTTGATTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003296.1-1150s1c1
Sequence:CCGGGTAGATGATGACAACTGTGAACTCGAGTTCACAGTTGTCATCATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-657s1c1
Sequence:CCGGGCTTGTTTGGTACTCGACTTACTCGAGTAAGTCGAGTACCAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-854s1c1
Sequence:CCGGGCCAGTATCAAGATCTCCTAACTCGAGTTAGGAGATCTTGATACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003296.1-1199s1c1
Sequence:CCGGGAACTGAATCAGGTTGAGGATCTCGAGATCCTCAACCTGATTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-463s1c1
Sequence:CCGGGCAAACAAGTGCACTTTACAACTCGAGTTGTAAAGTGCACTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-284s1c1
Sequence:CCGGCATCTTTACCTGCAGAAGGAACTCGAGTTCCTTCTGCAGGTAAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-865s1c1
Sequence:CCGGGATCTCCTAAGTAACTGTGATCTCGAGATCACAGTTACTTAGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003296
CRISP2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003296.2-1025s21c1
Sequence:CCGGTGGATAAGGGCTGCATCATTTCTCGAGAAATGATGCAGCCCTTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-852s21c1
Sequence:CCGGACAAAGGACTATGCACCAATACTCGAGTATTGGTGCATAGTCCTTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-775s21c1
Sequence:CCGGTGCTGGTAATAATATGAATAGCTCGAGCTATTCATATTATTACCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-704s1c1
Sequence:CCGGGTCCCAATCAAGATAGTCTAACTCGAGTTAGACTATCTTGATTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003296.1-1150s1c1
Sequence:CCGGGTAGATGATGACAACTGTGAACTCGAGTTCACAGTTGTCATCATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-657s1c1
Sequence:CCGGGCTTGTTTGGTACTCGACTTACTCGAGTAAGTCGAGTACCAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-854s1c1
Sequence:CCGGGCCAGTATCAAGATCTCCTAACTCGAGTTAGGAGATCTTGATACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003296.1-1199s1c1
Sequence:CCGGGAACTGAATCAGGTTGAGGATCTCGAGATCCTCAACCTGATTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-463s1c1
Sequence:CCGGGCAAACAAGTGCACTTTACAACTCGAGTTGTAAAGTGCACTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-284s1c1
Sequence:CCGGCATCTTTACCTGCAGAAGGAACTCGAGTTCCTTCTGCAGGTAAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-865s1c1
Sequence:CCGGGATCTCCTAAGTAACTGTGATCTCGAGATCACAGTTACTTAGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003296
CRISP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003296.2-1025s21c1
Sequence:CCGGTGGATAAGGGCTGCATCATTTCTCGAGAAATGATGCAGCCCTTATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-852s21c1
Sequence:CCGGACAAAGGACTATGCACCAATACTCGAGTATTGGTGCATAGTCCTTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003296.2-775s21c1
Sequence:CCGGTGCTGGTAATAATATGAATAGCTCGAGCTATTCATATTATTACCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-704s1c1
Sequence:CCGGGTCCCAATCAAGATAGTCTAACTCGAGTTAGACTATCTTGATTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003296.1-1150s1c1
Sequence:CCGGGTAGATGATGACAACTGTGAACTCGAGTTCACAGTTGTCATCATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-657s1c1
Sequence:CCGGGCTTGTTTGGTACTCGACTTACTCGAGTAAGTCGAGTACCAAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-854s1c1
Sequence:CCGGGCCAGTATCAAGATCTCCTAACTCGAGTTAGGAGATCTTGATACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003296.1-1199s1c1
Sequence:CCGGGAACTGAATCAGGTTGAGGATCTCGAGATCCTCAACCTGATTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-463s1c1
Sequence:CCGGGCAAACAAGTGCACTTTACAACTCGAGTTGTAAAGTGCACTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003296.1-284s1c1
Sequence:CCGGCATCTTTACCTGCAGAAGGAACTCGAGTTCCTTCTGCAGGTAAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003296.1-865s1c1
Sequence:CCGGGATCTCCTAAGTAACTGTGATCTCGAGATCACAGTTACTTAGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009420
CRISP2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-713s1c1
Sequence:CCGGGCCATTACTGTCCTATGGGTACTCGAGTACCCATAGGACAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-776s1c1
Sequence:CCGGCTTGTGCTAGTTGTCCCAATACTCGAGTATTGGGACAACTAGCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-286s1c1
Sequence:CCGGCCAGACTTTACTTCTTTGTTACTCGAGTAACAAAGAAGTAAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009420
CRISP2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-713s1c1
Sequence:CCGGGCCATTACTGTCCTATGGGTACTCGAGTACCCATAGGACAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-776s1c1
Sequence:CCGGCTTGTGCTAGTTGTCCCAATACTCGAGTATTGGGACAACTAGCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-286s1c1
Sequence:CCGGCCAGACTTTACTTCTTTGTTACTCGAGTAACAAAGAAGTAAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009420
CRISP2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-713s1c1
Sequence:CCGGGCCATTACTGTCCTATGGGTACTCGAGTACCCATAGGACAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-776s1c1
Sequence:CCGGCTTGTGCTAGTTGTCCCAATACTCGAGTATTGGGACAACTAGCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009420.1-286s1c1
Sequence:CCGGCCAGACTTTACTTCTTTGTTACTCGAGTAACAAAGAAGTAAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)