EMAIL THIS PAGE TO A FRIEND

CRISP3

cysteine-rich secretory protein 3

101 Gene Product Result for
Synonyms: Aeg2 CRISP-3 CRS3 SGP28 dJ442L6.3
Gene ID:
Mouse(11572) cysteine-rich secretory protein 3
domestic guinea pig(100732772) cysteine-rich secretory protein 3
Goat(100860899) cysteine-rich secretory protein 3
sheep(100462691) cysteine-rich secretory protein 3
dog(481834) cysteine-rich secretory protein 3
Horse(100033965) cysteine-rich secretory protein 3
cow(618612) cysteine-rich secretory protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1395 Human CRISP-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006061 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048271 MISSION® esiRNA esiRNA human CRISP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006061 Rosetta Predictions human pricing
NM_009639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340820 predicted 823
2 SASI_Hs01_00089900 predicted 538
3 SASI_Hs01_00089901 predicted 637
4 SASI_Hs01_00089902 predicted 424
5 SASI_Hs01_00089903 predicted 800
6 SASI_Hs01_00089904 predicted 429
7 SASI_Hs01_00089905 predicted 629
8 SASI_Hs01_00089907 predicted 800
9 SASI_Hs01_00089908 predicted 674
10 SASI_Hs01_00089909 predicted 249
11 SASI_Hs01_00089906 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196646 predicted 699
2 SASI_Mm01_00196647 predicted 527
3 SASI_Mm01_00196649 predicted 447
4 SASI_Mm01_00196650 predicted 646
5 SASI_Mm01_00196651 predicted 379
6 SASI_Mm01_00196652 predicted 541
7 SASI_Mm01_00196653 predicted 693
8 SASI_Mm01_00196654 predicted 785
9 SASI_Mm02_00316605 predicted 334
10 SASI_Mm02_00316606 predicted 783
11 SASI_Mm01_00196645 predicted 538
12 SASI_Mm01_00196648 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009639
CRISP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009639.1-841s1c1
Sequence:CCGGCCCACCAAGAATATATAGATTCTCGAGAATCTATATATTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-539s1c1
Sequence:CCGGGCTATTGTCCTGTATTGAATTCTCGAGAATTCAATACAGGACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-694s1c1
Sequence:CCGGCGTCTGGAATACGTCTGTAAACTCGAGTTTACAGACGTATTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-537s1c1
Sequence:CCGGTCGCTATTGTCCTGTATTGAACTCGAGTTCAATACAGGACAATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-106s1c1
Sequence:CCGGGAGAACAGTCTTGAGAAACTTCTCGAGAAGTTTCTCAAGACTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009639
CRISP3 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009639.1-841s1c1
Sequence:CCGGCCCACCAAGAATATATAGATTCTCGAGAATCTATATATTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-539s1c1
Sequence:CCGGGCTATTGTCCTGTATTGAATTCTCGAGAATTCAATACAGGACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-694s1c1
Sequence:CCGGCGTCTGGAATACGTCTGTAAACTCGAGTTTACAGACGTATTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-537s1c1
Sequence:CCGGTCGCTATTGTCCTGTATTGAACTCGAGTTCAATACAGGACAATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-106s1c1
Sequence:CCGGGAGAACAGTCTTGAGAAACTTCTCGAGAAGTTTCTCAAGACTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009639
CRISP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009639.1-841s1c1
Sequence:CCGGCCCACCAAGAATATATAGATTCTCGAGAATCTATATATTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-539s1c1
Sequence:CCGGGCTATTGTCCTGTATTGAATTCTCGAGAATTCAATACAGGACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-694s1c1
Sequence:CCGGCGTCTGGAATACGTCTGTAAACTCGAGTTTACAGACGTATTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-537s1c1
Sequence:CCGGTCGCTATTGTCCTGTATTGAACTCGAGTTCAATACAGGACAATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009639.1-106s1c1
Sequence:CCGGGAGAACAGTCTTGAGAAACTTCTCGAGAAGTTTCTCAAGACTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006061
CRISP3 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1615s1c1
Sequence:CCGGCGTCACCAGTGATAAGTCATTCTCGAGAATGACTTATCACTGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1840s1c1
Sequence:CCGGGCCAAATGCAATGTGCTTCTTCTCGAGAAGAAGCACATTGCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-267s1c1
Sequence:CCGGCAGTAACCCAAAGGATCGAATCTCGAGATTCGATCCTTTGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-598s1c1
Sequence:CCGGCCAGATAACTGTGACGATGGACTCGAGTCCATCGTCACAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-333s1c1
Sequence:CCGGCAGCTCATGGTCACAAGCAATCTCGAGATTGCTTGTGACCATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-462s1c1
Sequence:CCGGCGTTGGATGTGGAAATGCCTACTCGAGTAGGCATTTCCACATCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-434s1c1
Sequence:CCGGCACAGGTTGTTTGGTACTCTTCTCGAGAAGAGTACCAAACAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1972s1c1
Sequence:CCGGGCAGGGTAATGTAAGATGATACTCGAGTATCATCTTACATTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-252s1c1
Sequence:CCGGGTGCAATTACAGACACAGTAACTCGAGTTACTGTGTCTGTAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-672s1c1
Sequence:CCGGGAAGCTCACATTAACCTGTAACTCGAGTTACAGGTTAATGTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006061.1-1620s1c1
Sequence:CCGGCCAGTGATAAGTCATTCAGATCTCGAGATCTGAATGACTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006061
CRISP3 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1615s1c1
Sequence:CCGGCGTCACCAGTGATAAGTCATTCTCGAGAATGACTTATCACTGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1840s1c1
Sequence:CCGGGCCAAATGCAATGTGCTTCTTCTCGAGAAGAAGCACATTGCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-267s1c1
Sequence:CCGGCAGTAACCCAAAGGATCGAATCTCGAGATTCGATCCTTTGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-598s1c1
Sequence:CCGGCCAGATAACTGTGACGATGGACTCGAGTCCATCGTCACAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-333s1c1
Sequence:CCGGCAGCTCATGGTCACAAGCAATCTCGAGATTGCTTGTGACCATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-462s1c1
Sequence:CCGGCGTTGGATGTGGAAATGCCTACTCGAGTAGGCATTTCCACATCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-434s1c1
Sequence:CCGGCACAGGTTGTTTGGTACTCTTCTCGAGAAGAGTACCAAACAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1972s1c1
Sequence:CCGGGCAGGGTAATGTAAGATGATACTCGAGTATCATCTTACATTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-252s1c1
Sequence:CCGGGTGCAATTACAGACACAGTAACTCGAGTTACTGTGTCTGTAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-672s1c1
Sequence:CCGGGAAGCTCACATTAACCTGTAACTCGAGTTACAGGTTAATGTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006061.1-1620s1c1
Sequence:CCGGCCAGTGATAAGTCATTCAGATCTCGAGATCTGAATGACTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006061
CRISP3 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1615s1c1
Sequence:CCGGCGTCACCAGTGATAAGTCATTCTCGAGAATGACTTATCACTGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1840s1c1
Sequence:CCGGGCCAAATGCAATGTGCTTCTTCTCGAGAAGAAGCACATTGCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-267s1c1
Sequence:CCGGCAGTAACCCAAAGGATCGAATCTCGAGATTCGATCCTTTGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-598s1c1
Sequence:CCGGCCAGATAACTGTGACGATGGACTCGAGTCCATCGTCACAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-333s1c1
Sequence:CCGGCAGCTCATGGTCACAAGCAATCTCGAGATTGCTTGTGACCATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-462s1c1
Sequence:CCGGCGTTGGATGTGGAAATGCCTACTCGAGTAGGCATTTCCACATCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006061.1-434s1c1
Sequence:CCGGCACAGGTTGTTTGGTACTCTTCTCGAGAAGAGTACCAAACAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006061.1-1972s1c1
Sequence:CCGGGCAGGGTAATGTAAGATGATACTCGAGTATCATCTTACATTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-252s1c1
Sequence:CCGGGTGCAATTACAGACACAGTAACTCGAGTTACTGTGTCTGTAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006061.1-672s1c1
Sequence:CCGGGAAGCTCACATTAACCTGTAACTCGAGTTACAGGTTAATGTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006061.1-1620s1c1
Sequence:CCGGCCAGTGATAAGTCATTCAGATCTCGAGATCTGAATGACTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks