EMAIL THIS PAGE TO A FRIEND

CRISPLD1

cysteine-rich secretory protein LCCL domain containing 1

130 Gene Product Result for
Synonyms: CRISP10 LCRISP1
UniProtKB ID: Q9H336, B2RA60
Gene ID:
Mouse(83691) cysteine-rich secretory protein LCCL domain containing 1
Rat(316482) cysteine-rich secretory protein LCCL domain containing 1
domestic guinea pig(100735804) cysteine-rich secretory protein LCCL domain containing 1
naked mole-rat(101719099) cysteine-rich secretory protein LCCL domain containing 1
sheep(101109455) cysteine-rich secretory protein LCCL domain containing 1
Domestic Rabbit(100342278) cysteine-rich secretory protein LCCL domain containing 1
chicken(395369) cysteine-rich secretory protein LCCL domain containing 1
domestic cat(101089834) cysteine-rich secretory protein LCCL domain containing 1
cow(536186) cysteine-rich secretory protein LCCL domain containing 1
Horse(100050859) cysteine-rich secretory protein LCCL domain containing 1
dog(487004) cysteine-rich secretory protein LCCL domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031461 Rosetta Predictions human pricing
NM_001134963 Rosetta Predictions rat pricing
NM_031402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178585 predicted 1375
2 SASI_Hs01_00178586 predicted 1145
3 SASI_Hs01_00178587 predicted 1352
4 SASI_Hs01_00178588 predicted 1514
5 SASI_Hs01_00178589 predicted 1467
6 SASI_Hs01_00178590 predicted 679
7 SASI_Hs01_00178591 predicted 696
8 SASI_Hs02_00358885 predicted 1754
9 SASI_Hs01_00178592 predicted 1822
10 SASI_Hs01_00178593 predicted 1252
11 SASI_Hs01_00178594 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259134 predicted 2304
2 SASI_Rn02_00259135 predicted 904
3 SASI_Rn02_00259136 predicted 1869
4 SASI_Rn02_00259137 predicted 806
5 SASI_Rn02_00259138 predicted 1074
6 SASI_Rn02_00259139 predicted 2293
7 SASI_Rn02_00259140 predicted 1900
8 SASI_Rn02_00259141 predicted 1530
9 SASI_Rn02_00259142 predicted 2041
10 SASI_Rn02_00259143 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063693 predicted 834
2 SASI_Mm02_00337149 predicted 549
3 SASI_Mm01_00063696 predicted 814
4 SASI_Mm01_00063697 predicted 948
5 SASI_Mm02_00337150 predicted 592
6 SASI_Mm01_00063698 predicted 1506
7 SASI_Mm01_00063699 predicted 447
8 SASI_Mm01_00063700 predicted 1170
9 SASI_Mm01_00063701 predicted 892
10 SASI_Mm01_00063702 predicted 1644
11 SASI_Mm01_00063694 predicted 1955
12 SASI_Mm01_00063695 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031461
CRISPLD1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein LCCL domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031461.4-603s21c1
Sequence:CCGGGTATCCAACAGCCTCTAATATCTCGAGATATTAGAGGCTGTTGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031461.4-2185s21c1
Sequence:CCGGCTTTGTATATGCCACTAATAACTCGAGTTATTAGTGGCATATACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-550s1c1
Sequence:CCGGGACAATGACATGCAGAGTATTCTCGAGAATACTCTGCATGTCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1852s1c1
Sequence:CCGGGCATTCAGAGTGTTTGCTGTTCTCGAGAACAGCAAACACTCTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-460s1c1
Sequence:CCGGGCCACTTTATTGGAGAAACTTCTCGAGAAGTTTCTCCAATAAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1633s1c1
Sequence:CCGGCGTAACTGTATGCAAGCAAATCTCGAGATTTGCTTGCATACAGTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1746s1c1
Sequence:CCGGCGGTGGTTATGTTGATGTAATCTCGAGATTACATCAACATAACCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1804s1c1
Sequence:CCGGCAGAATGGAATCTTCTCAGAACTCGAGTTCTGAGAAGATTCCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1339s1c1
Sequence:CCGGGCTAAAGTTATTGGCAGTGTACTCGAGTACACTGCCAATAACTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-676s1c1
Sequence:CCGGGAAAGTTGCTTGTGGGAACATCTCGAGATGTTCCCACAAGCAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031461
CRISPLD1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein LCCL domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031461.4-603s21c1
Sequence:CCGGGTATCCAACAGCCTCTAATATCTCGAGATATTAGAGGCTGTTGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031461.4-2185s21c1
Sequence:CCGGCTTTGTATATGCCACTAATAACTCGAGTTATTAGTGGCATATACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-550s1c1
Sequence:CCGGGACAATGACATGCAGAGTATTCTCGAGAATACTCTGCATGTCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1852s1c1
Sequence:CCGGGCATTCAGAGTGTTTGCTGTTCTCGAGAACAGCAAACACTCTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-460s1c1
Sequence:CCGGGCCACTTTATTGGAGAAACTTCTCGAGAAGTTTCTCCAATAAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1633s1c1
Sequence:CCGGCGTAACTGTATGCAAGCAAATCTCGAGATTTGCTTGCATACAGTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1746s1c1
Sequence:CCGGCGGTGGTTATGTTGATGTAATCTCGAGATTACATCAACATAACCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1804s1c1
Sequence:CCGGCAGAATGGAATCTTCTCAGAACTCGAGTTCTGAGAAGATTCCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1339s1c1
Sequence:CCGGGCTAAAGTTATTGGCAGTGTACTCGAGTACACTGCCAATAACTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-676s1c1
Sequence:CCGGGAAAGTTGCTTGTGGGAACATCTCGAGATGTTCCCACAAGCAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031461
CRISPLD1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein LCCL domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031461.4-603s21c1
Sequence:CCGGGTATCCAACAGCCTCTAATATCTCGAGATATTAGAGGCTGTTGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031461.4-2185s21c1
Sequence:CCGGCTTTGTATATGCCACTAATAACTCGAGTTATTAGTGGCATATACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-550s1c1
Sequence:CCGGGACAATGACATGCAGAGTATTCTCGAGAATACTCTGCATGTCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1852s1c1
Sequence:CCGGGCATTCAGAGTGTTTGCTGTTCTCGAGAACAGCAAACACTCTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-460s1c1
Sequence:CCGGGCCACTTTATTGGAGAAACTTCTCGAGAAGTTTCTCCAATAAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1633s1c1
Sequence:CCGGCGTAACTGTATGCAAGCAAATCTCGAGATTTGCTTGCATACAGTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1746s1c1
Sequence:CCGGCGGTGGTTATGTTGATGTAATCTCGAGATTACATCAACATAACCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031461.2-1804s1c1
Sequence:CCGGCAGAATGGAATCTTCTCAGAACTCGAGTTCTGAGAAGATTCCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-1339s1c1
Sequence:CCGGGCTAAAGTTATTGGCAGTGTACTCGAGTACACTGCCAATAACTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031461.2-676s1c1
Sequence:CCGGGAAAGTTGCTTGTGGGAACATCTCGAGATGTTCCCACAAGCAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031402
CRISPLD1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein LCCL domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031402.1-2220s1c1
Sequence:CCGGCCACTGATGAAGTATATCTAACTCGAGTTAGATATACTTCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1665s1c1
Sequence:CCGGCGAAACTGTATGCAGTCAAATCTCGAGATTTGACTGCATACAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-746s1c1
Sequence:CCGGGCCCTCCATTGGACAGAATTTCTCGAGAAATTCTGTCCAATGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1507s1c1
Sequence:CCGGCCAACAGAAATGGCATTCAAACTCGAGTTTGAATGCCATTTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1425s1c1
Sequence:CCGGGCCATCCACTATGGGATAATACTCGAGTATTATCCCATAGTGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031402
CRISPLD1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein LCCL domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031402.1-2220s1c1
Sequence:CCGGCCACTGATGAAGTATATCTAACTCGAGTTAGATATACTTCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1665s1c1
Sequence:CCGGCGAAACTGTATGCAGTCAAATCTCGAGATTTGACTGCATACAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-746s1c1
Sequence:CCGGGCCCTCCATTGGACAGAATTTCTCGAGAAATTCTGTCCAATGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1507s1c1
Sequence:CCGGCCAACAGAAATGGCATTCAAACTCGAGTTTGAATGCCATTTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1425s1c1
Sequence:CCGGGCCATCCACTATGGGATAATACTCGAGTATTATCCCATAGTGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031402
CRISPLD1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein LCCL domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031402.1-2220s1c1
Sequence:CCGGCCACTGATGAAGTATATCTAACTCGAGTTAGATATACTTCATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1665s1c1
Sequence:CCGGCGAAACTGTATGCAGTCAAATCTCGAGATTTGACTGCATACAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-746s1c1
Sequence:CCGGGCCCTCCATTGGACAGAATTTCTCGAGAAATTCTGTCCAATGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1507s1c1
Sequence:CCGGCCAACAGAAATGGCATTCAAACTCGAGTTTGAATGCCATTTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031402.1-1425s1c1
Sequence:CCGGGCCATCCACTATGGGATAATACTCGAGTATTATCCCATAGTGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)