EMAIL THIS PAGE TO A FRIEND

CRISPLD2

cysteine-rich secretory protein LCCL domain containing 2

112 Gene Product Result for
Synonyms: CRISP11 LCRISP2
Gene ID:
Mouse(78892) cysteine-rich secretory protein LCCL domain containing 2
Rat(171547) cysteine-rich secretory protein LCCL domain containing 2
chicken(415818) cysteine-rich secretory protein LCCL domain containing 2
domestic cat(101083052) cysteine-rich secretory protein LCCL domain containing 2
cow(505329) cysteine-rich secretory protein LCCL domain containing 2
Horse(100070252) cysteine-rich secretory protein LCCL domain containing 2
dog(489677) cysteine-rich secretory protein LCCL domain containing 2
sheep(101102507) cysteine-rich secretory protein LCCL domain containing 2
naked mole-rat(101698187) cysteine-rich secretory protein LCCL domain containing 2
domestic guinea pig(100715636) cysteine-rich secretory protein LCCL domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039191 MISSION® esiRNA esiRNA human CRISPLD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031476 Rosetta Predictions human pricing
NM_138518 Rosetta Predictions rat pricing
NM_030209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155199 predicted 1482
2 SASI_Hs01_00155200 predicted 883
3 SASI_Hs01_00155201 predicted 1683
4 SASI_Hs01_00155202 predicted 1471
5 SASI_Hs01_00155203 predicted 893
6 SASI_Hs01_00155204 predicted 1413
7 SASI_Hs01_00155205 predicted 1664
8 SASI_Hs01_00155206 predicted 1461
9 SASI_Hs01_00155208 predicted 778
10 SASI_Hs02_00358907 predicted 662
11 SASI_Hs01_00155207 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268128 predicted 660
2 SASI_Rn01_00065925 predicted 1000
3 SASI_Rn01_00065927 predicted 1065
4 SASI_Rn02_00268129 predicted 1643
5 SASI_Rn02_00268130 predicted 871
6 SASI_Rn01_00065931 predicted 647
7 SASI_Rn02_00268131 predicted 1338
8 SASI_Rn02_00268132 predicted 1352
9 SASI_Rn02_00268133 predicted 237
10 SASI_Rn01_00065932 predicted 1176
11 SASI_Rn01_00065924 predicted 1206
12 SASI_Rn01_00065926 predicted 657
13 SASI_Rn01_00065928 predicted 780
14 SASI_Rn01_00065929 predicted 1142
15 SASI_Rn01_00065930 predicted 699
16 SASI_Rn01_00065933 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104951 predicted 1570
2 SASI_Mm01_00104952 predicted 1498
3 SASI_Mm02_00336638 predicted 485
4 SASI_Mm01_00104954 predicted 1476
5 SASI_Mm01_00104955 predicted 1460
6 SASI_Mm01_00104956 predicted 895
7 SASI_Mm01_00104957 predicted 1193
8 SASI_Mm01_00104958 predicted 785
9 SASI_Mm01_00104959 predicted 1665
10 SASI_Mm01_00104960 predicted 1467
11 SASI_Mm01_00104953 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031476
VALIDATED
CRISPLD2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein LCCL domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-4342s1c1
Sequence:CCGGCCGCAGTTTATGTGTGTGCTTCTCGAGAAGCACACACATAAACTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031476.1-1331s1c1
Sequence:CCGGCCAGCTCATTCATGGTGTCAACTCGAGTTGACACCATGAATGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-2132s1c1
Sequence:CCGGCCAATGAGTTTCAGGAATGAACTCGAGTTCATTCCTGAAACTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031476.1-1065s1c1
Sequence:CCGGCGTCAGATGTGACACCAAGATCTCGAGATCTTGGTGTCACATCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1599s21c1
Sequence:CCGGGACGTGATGCCCGTGGATAAACTCGAGTTTATCCACGGGCATCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1168s21c1
Sequence:CCGGACCACAAGGCGAAGATCTTTGCTCGAGCAAAGATCTTCGCCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-808s21c1
Sequence:CCGGTCTACTTTGTCTGCAATTATTCTCGAGAATAATTGCAGACAAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1201s21c1
Sequence:CCGGATGAAAGCTCGTCTAGCATATCTCGAGATATGCTAGACGAGCTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031476
VALIDATED
CRISPLD2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein LCCL domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-4342s1c1
Sequence:CCGGCCGCAGTTTATGTGTGTGCTTCTCGAGAAGCACACACATAAACTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031476.1-1331s1c1
Sequence:CCGGCCAGCTCATTCATGGTGTCAACTCGAGTTGACACCATGAATGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-2132s1c1
Sequence:CCGGCCAATGAGTTTCAGGAATGAACTCGAGTTCATTCCTGAAACTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031476.1-1065s1c1
Sequence:CCGGCGTCAGATGTGACACCAAGATCTCGAGATCTTGGTGTCACATCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1599s21c1
Sequence:CCGGGACGTGATGCCCGTGGATAAACTCGAGTTTATCCACGGGCATCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1168s21c1
Sequence:CCGGACCACAAGGCGAAGATCTTTGCTCGAGCAAAGATCTTCGCCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-808s21c1
Sequence:CCGGTCTACTTTGTCTGCAATTATTCTCGAGAATAATTGCAGACAAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1201s21c1
Sequence:CCGGATGAAAGCTCGTCTAGCATATCTCGAGATATGCTAGACGAGCTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031476
VALIDATED
CRISPLD2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein LCCL domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-4342s1c1
Sequence:CCGGCCGCAGTTTATGTGTGTGCTTCTCGAGAAGCACACACATAAACTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031476.1-1331s1c1
Sequence:CCGGCCAGCTCATTCATGGTGTCAACTCGAGTTGACACCATGAATGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031476.1-2132s1c1
Sequence:CCGGCCAATGAGTTTCAGGAATGAACTCGAGTTCATTCCTGAAACTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031476.1-1065s1c1
Sequence:CCGGCGTCAGATGTGACACCAAGATCTCGAGATCTTGGTGTCACATCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1599s21c1
Sequence:CCGGGACGTGATGCCCGTGGATAAACTCGAGTTTATCCACGGGCATCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1168s21c1
Sequence:CCGGACCACAAGGCGAAGATCTTTGCTCGAGCAAAGATCTTCGCCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-808s21c1
Sequence:CCGGTCTACTTTGTCTGCAATTATTCTCGAGAATAATTGCAGACAAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031476.3-1201s21c1
Sequence:CCGGATGAAAGCTCGTCTAGCATATCTCGAGATATGCTAGACGAGCTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030209
CRISPLD2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich secretory protein LCCL domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030209.2-2291s1c1
Sequence:CCGGCCAGAGATTTATCTTGTCTTTCTCGAGAAAGACAAGATAAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1483s1c1
Sequence:CCGGCCAACATCTATGCTGATACTTCTCGAGAAGTATCAGCATAGATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-791s1c1
Sequence:CCGGCGTCTGCAATTATTCTCCCAACTCGAGTTGGGAGAATAATTGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1265s1c1
Sequence:CCGGCTTCTTTGTCAAGTCTCAGAACTCGAGTTCTGAGACTTGACAAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-602s1c1
Sequence:CCGGCGAGGTGAAGGATTACACCTACTCGAGTAGGTGTAATCCTTCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030209
CRISPLD2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich secretory protein LCCL domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030209.2-2291s1c1
Sequence:CCGGCCAGAGATTTATCTTGTCTTTCTCGAGAAAGACAAGATAAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1483s1c1
Sequence:CCGGCCAACATCTATGCTGATACTTCTCGAGAAGTATCAGCATAGATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-791s1c1
Sequence:CCGGCGTCTGCAATTATTCTCCCAACTCGAGTTGGGAGAATAATTGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1265s1c1
Sequence:CCGGCTTCTTTGTCAAGTCTCAGAACTCGAGTTCTGAGACTTGACAAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-602s1c1
Sequence:CCGGCGAGGTGAAGGATTACACCTACTCGAGTAGGTGTAATCCTTCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030209
CRISPLD2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich secretory protein LCCL domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030209.2-2291s1c1
Sequence:CCGGCCAGAGATTTATCTTGTCTTTCTCGAGAAAGACAAGATAAATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1483s1c1
Sequence:CCGGCCAACATCTATGCTGATACTTCTCGAGAAGTATCAGCATAGATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-791s1c1
Sequence:CCGGCGTCTGCAATTATTCTCCCAACTCGAGTTGGGAGAATAATTGCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-1265s1c1
Sequence:CCGGCTTCTTTGTCAAGTCTCAGAACTCGAGTTCTGAGACTTGACAAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030209.2-602s1c1
Sequence:CCGGCGAGGTGAAGGATTACACCTACTCGAGTAGGTGTAATCCTTCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)