EMAIL THIS PAGE TO A FRIEND

CRKL

v-crk avian sarcoma virus CT10 oncogene homolog-like

198 Gene Product Result for
UniProtKB ID: P46109, A8KA44, D3DX35
Gene ID:
Human(1399) Summary: This gene encodes a protein kinase containing SH2 and SH3 (src homology) domains which has been shown to activate the RAS and JUN kinase signaling pathways and transform fibroblasts in a RAS-dependent fashion. It is a substrate of the BCR-ABL tyrosine kinase, plays a role in fibroblast transformation by BCR-ABL, and may be oncogenic.[provided by RefSeq, Jan 2009]
Mouse(12929) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
Rat(287942) v-crk avian sarcoma virus CT10 oncogene homolog-like
Zebrafish(556443) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
dog(608125) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
domestic cat(101084908) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
cow(518180) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
chicken(416939) v-crk sarcoma virus CT10 oncogene homolog-like
sheep(101117537) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
naked mole-rat(101705695) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
domestic guinea pig(100723968) v-crk sarcoma virus CT10 oncogene homolog (avian)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C0978 Anti-Crk-L antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunoprecipitation, microarray, western blot pricing
SAB2500274 Anti-CRKL antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405659 Anti-CRKL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001100 Anti-CRKL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
AV01043 Anti-CRKL antibody produced in rabbit affinity isolated antibody human, bovine, rat, mouse, canine
western blot pricing
SAB4500471 Anti-CRKL antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA000532 Anti-CRKL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4503814 Anti-phospho-CrkL (pTyr207) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0001399M3 Monoclonal Anti-CRKL antibody produced in mouse clone 4B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300320 Monoclonal Anti-CRKL antibody produced in mouse clone 5E12, ascites fluid human
ELISA, flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005207 siRNAs that have been validated in the lab human pricing
NM_001008284 Rosetta Predictions rat pricing
NM_007764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005207 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177768 validated 1307
1 SASI_Hs01_00177769 validated 1491
2 SASI_Hs02_00339178 predicted 1294
3 SASI_Hs02_00339179 predicted 1469
4 SASI_Hs01_00177770 predicted 1414
5 SASI_Hs01_00177771 predicted 1547
6 SASI_Hs01_00177772 predicted 1074
7 SASI_Hs01_00177774 predicted 1601
8 SASI_Hs01_00177775 predicted 948
9 SASI_Hs01_00177776 predicted 1205
10 SASI_Hs02_00339180 predicted 1586
11 SASI_Hs01_00177767 predicted 605
12 SASI_Hs01_00177773 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082367 predicted 1049
2 SASI_Rn01_00082368 predicted 920
3 SASI_Rn01_00082369 predicted 1180
4 SASI_Rn01_00082370 predicted 1217
5 SASI_Rn01_00082371 predicted 1275
6 SASI_Rn01_00082372 predicted 889
7 SASI_Rn01_00082373 predicted 1258
8 SASI_Rn01_00082374 predicted 1283
9 SASI_Rn01_00082375 predicted 490
10 SASI_Rn01_00082376 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093868 predicted 1051
2 SASI_Mm01_00093869 predicted 726
3 SASI_Mm01_00093871 predicted 1286
4 SASI_Mm01_00093873 predicted 1586
5 SASI_Mm01_00093874 predicted 1600
6 SASI_Mm01_00093875 predicted 905
7 SASI_Mm01_00093876 predicted 1270
8 SASI_Mm02_00312390 predicted 1216
9 SASI_Mm01_00093877 predicted 582
10 SASI_Mm02_00312391 predicted 1123
11 SASI_Mm01_00093870 predicted 1188
12 SASI_Mm01_00093872 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005207
VALIDATED
CRKL MISSION shRNA Bacterial Glycerol Stock
v-crk avian sarcoma virus CT10 oncogene homolog-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005207.2-4246s1c1
Sequence:CCGGGCTCTGCTCTACCATGTTTAACTCGAGTTAAACATGGTAGAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-869s1c1
Sequence:CCGGAGCAGAAGATAACCTGGAATACTCGAGTATTCCAGGTTATCTTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1216s1c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1298s1c1
Sequence:CCGGCGTGAAAGTCACAAGGATGAACTCGAGTTCATCCTTGTGACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1065s1c1
Sequence:CCGGCCACACGGAAAGCATGGAAATCTCGAGATTTCCATGCTTTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1847s21c1
Sequence:CCGGCAACAGGAAGTGAACCTTAAGCTCGAGCTTAAGGTTCACTTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-2922s21c1
Sequence:CCGGGTGACTAGGGAGACCATTAACCTCGAGGTTAATGGTCTCCCTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-924s21c1
Sequence:CCGGGCCGAAGACCTGCCCTTTAAACTCGAGTTTAAAGGGCAGGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-890s21c1
Sequence:CCGGTGTACGGACTCTGTATGATTTCTCGAGAAATCATACAGAGTCCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-949s21c1
Sequence:CCGGGTGAGATCCTAGTGATAATAGCTCGAGCTATTATCACTAGGATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1216s21c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005207
VALIDATED
CRKL MISSION shRNA shRNA Plasmid DNA
v-crk avian sarcoma virus CT10 oncogene homolog-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005207.2-4246s1c1
Sequence:CCGGGCTCTGCTCTACCATGTTTAACTCGAGTTAAACATGGTAGAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-869s1c1
Sequence:CCGGAGCAGAAGATAACCTGGAATACTCGAGTATTCCAGGTTATCTTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1216s1c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1298s1c1
Sequence:CCGGCGTGAAAGTCACAAGGATGAACTCGAGTTCATCCTTGTGACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1065s1c1
Sequence:CCGGCCACACGGAAAGCATGGAAATCTCGAGATTTCCATGCTTTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1847s21c1
Sequence:CCGGCAACAGGAAGTGAACCTTAAGCTCGAGCTTAAGGTTCACTTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-2922s21c1
Sequence:CCGGGTGACTAGGGAGACCATTAACCTCGAGGTTAATGGTCTCCCTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-924s21c1
Sequence:CCGGGCCGAAGACCTGCCCTTTAAACTCGAGTTTAAAGGGCAGGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-890s21c1
Sequence:CCGGTGTACGGACTCTGTATGATTTCTCGAGAAATCATACAGAGTCCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-949s21c1
Sequence:CCGGGTGAGATCCTAGTGATAATAGCTCGAGCTATTATCACTAGGATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1216s21c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005207
VALIDATED
CRKL MISSION shRNA Lentiviral Transduction Particles
v-crk avian sarcoma virus CT10 oncogene homolog-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005207.2-4246s1c1
Sequence:CCGGGCTCTGCTCTACCATGTTTAACTCGAGTTAAACATGGTAGAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-869s1c1
Sequence:CCGGAGCAGAAGATAACCTGGAATACTCGAGTATTCCAGGTTATCTTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1216s1c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1298s1c1
Sequence:CCGGCGTGAAAGTCACAAGGATGAACTCGAGTTCATCCTTGTGACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005207.2-1065s1c1
Sequence:CCGGCCACACGGAAAGCATGGAAATCTCGAGATTTCCATGCTTTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1847s21c1
Sequence:CCGGCAACAGGAAGTGAACCTTAAGCTCGAGCTTAAGGTTCACTTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-2922s21c1
Sequence:CCGGGTGACTAGGGAGACCATTAACCTCGAGGTTAATGGTCTCCCTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-924s21c1
Sequence:CCGGGCCGAAGACCTGCCCTTTAAACTCGAGTTTAAAGGGCAGGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005207.2-890s21c1
Sequence:CCGGTGTACGGACTCTGTATGATTTCTCGAGAAATCATACAGAGTCCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.2-949s21c1
Sequence:CCGGGTGAGATCCTAGTGATAATAGCTCGAGCTATTATCACTAGGATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005207.3-1216s21c1
Sequence:CCGGGACCTGTCTTTGCGAAAGCAACTCGAGTTGCTTTCGCAAAGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007764
VALIDATED
CRKL MISSION shRNA Bacterial Glycerol Stock
v-crk avian sarcoma virus CT10 oncogene homolog-like
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-2882s1c1
Sequence:CCGGGCCTACATACATACCTTGTATCTCGAGATACAAGGTATGTATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-767s1c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-1260s1c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007764.2-837s1c1
Sequence:CCGGCCCAACTTACCTACAGCAGAACTCGAGTTCTGCTGTAGGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-867s1c1
Sequence:CCGGGAATATGTACGGACCCTTTATCTCGAGATAAAGGGTCCGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1465s21c1
Sequence:CCGGACTCTGTCACATGCAAGTTACCTCGAGGTAACTTGCATGTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-906s21c1
Sequence:CCGGGCTGAAGACCTACCCTTTAAACTCGAGTTTAAAGGGTAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-931s21c1
Sequence:CCGGGCGAGCTTCTAGTGATAATAGCTCGAGCTATTATCACTAGAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-767s21c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-713s21c1
Sequence:CCGGGGACCAGGAGTTTGACCATTTCTCGAGAAATGGTCAAACTCCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-2608s21c1
Sequence:CCGGAGTGAGCAGCTCTAGCATTTACTCGAGTAAATGCTAGAGCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1260s21c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007764.4-1386s21c1
Sequence:CCGGCCCGATGACAACGAGTGATTGCTCGAGCAATCACTCGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007764
VALIDATED
CRKL MISSION shRNA shRNA Plasmid DNA
v-crk avian sarcoma virus CT10 oncogene homolog-like
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-2882s1c1
Sequence:CCGGGCCTACATACATACCTTGTATCTCGAGATACAAGGTATGTATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-767s1c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-1260s1c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007764.2-837s1c1
Sequence:CCGGCCCAACTTACCTACAGCAGAACTCGAGTTCTGCTGTAGGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-867s1c1
Sequence:CCGGGAATATGTACGGACCCTTTATCTCGAGATAAAGGGTCCGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1465s21c1
Sequence:CCGGACTCTGTCACATGCAAGTTACCTCGAGGTAACTTGCATGTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-906s21c1
Sequence:CCGGGCTGAAGACCTACCCTTTAAACTCGAGTTTAAAGGGTAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-931s21c1
Sequence:CCGGGCGAGCTTCTAGTGATAATAGCTCGAGCTATTATCACTAGAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-767s21c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-713s21c1
Sequence:CCGGGGACCAGGAGTTTGACCATTTCTCGAGAAATGGTCAAACTCCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-2608s21c1
Sequence:CCGGAGTGAGCAGCTCTAGCATTTACTCGAGTAAATGCTAGAGCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1260s21c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007764.4-1386s21c1
Sequence:CCGGCCCGATGACAACGAGTGATTGCTCGAGCAATCACTCGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007764
VALIDATED
CRKL MISSION shRNA Lentiviral Transduction Particles
v-crk avian sarcoma virus CT10 oncogene homolog-like
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-2882s1c1
Sequence:CCGGGCCTACATACATACCTTGTATCTCGAGATACAAGGTATGTATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-767s1c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-1260s1c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007764.2-837s1c1
Sequence:CCGGCCCAACTTACCTACAGCAGAACTCGAGTTCTGCTGTAGGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007764.2-867s1c1
Sequence:CCGGGAATATGTACGGACCCTTTATCTCGAGATAAAGGGTCCGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1465s21c1
Sequence:CCGGACTCTGTCACATGCAAGTTACCTCGAGGTAACTTGCATGTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-906s21c1
Sequence:CCGGGCTGAAGACCTACCCTTTAAACTCGAGTTTAAAGGGTAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-931s21c1
Sequence:CCGGGCGAGCTTCTAGTGATAATAGCTCGAGCTATTATCACTAGAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-767s21c1
Sequence:CCGGCCTGGACACTACCACCTTAATCTCGAGATTAAGGTGGTAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-713s21c1
Sequence:CCGGGGACCAGGAGTTTGACCATTTCTCGAGAAATGGTCAAACTCCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-2608s21c1
Sequence:CCGGAGTGAGCAGCTCTAGCATTTACTCGAGTAAATGCTAGAGCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007764.4-1260s21c1
Sequence:CCGGGCATTGGAGGTTGGTGACATTCTCGAGAATGTCACCAACCTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007764.4-1386s21c1
Sequence:CCGGCCCGATGACAACGAGTGATTGCTCGAGCAATCACTCGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks