EMAIL THIS PAGE TO A FRIEND

CRLF1

cytokine receptor-like factor 1

70 Gene Product Result for
Synonyms: CISS CISS1 CLF CLF-1 NR6 zcytor5
UniProtKB ID: O75462, Q9UHH5
Gene ID:
Human(9244) Summary: This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]
Mouse(12931) cytokine receptor-like factor 1
Rat(290655) cytokine receptor-like factor 1
sheep(101108913) cytokine receptor-like factor 1
domestic guinea pig(100719758) cytokine receptor-like factor 1
naked mole-rat(101701148) cytokine receptor-like factor 1
chicken(100858730) cytokine receptor-like factor 1
domestic cat(101095558) cytokine receptor-like factor 1
cow(511086) cytokine receptor-like factor 1
dog(484818) cytokine receptor-like factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004750 Rosetta Predictions human pricing
NM_001106074 Rosetta Predictions rat pricing
XM_214312 Rosetta Predictions rat pricing
NM_018827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164266 predicted 595
2 SASI_Hs01_00164267 predicted 688
3 SASI_Hs01_00164268 predicted 619
4 SASI_Hs01_00164269 predicted 717
5 SASI_Hs01_00164270 predicted 859
6 SASI_Hs01_00164271 predicted 636
7 SASI_Hs01_00164272 predicted 975
8 SASI_Hs01_00164273 predicted 851
9 SASI_Hs01_00164274 predicted 686
10 SASI_Hs01_00164275 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215372 predicted 1038
2 SASI_Rn02_00215373 predicted 1047
3 SASI_Rn02_00215374 predicted 1372
4 SASI_Rn02_00215375 predicted 575
5 SASI_Rn02_00215376 predicted 1240
6 SASI_Rn02_00215377 predicted 907
7 SASI_Rn02_00215378 predicted 932
8 SASI_Rn02_00215379 predicted 1062
9 SASI_Rn02_00215380 predicted 1047
10 SASI_Rn02_00215381 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136003 predicted 1046
2 SASI_Rn01_00136004 predicted 1052
3 SASI_Rn01_00136005 predicted 1378
4 SASI_Rn01_00136006 predicted 1043
5 SASI_Rn01_00136007 predicted 1253
6 SASI_Rn01_00136008 predicted 1039
7 SASI_Rn01_00136009 predicted 941
8 SASI_Rn01_00136010 predicted 1062
9 SASI_Rn01_00136011 predicted 1049
10 SASI_Rn01_00136012 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131272 predicted 686
2 SASI_Mm01_00131273 predicted 1240
3 SASI_Mm01_00131274 predicted 1039
4 SASI_Mm01_00131275 predicted 1379
5 SASI_Mm01_00131276 predicted 906
6 SASI_Mm01_00131277 predicted 647
7 SASI_Mm02_00324175 predicted 572
8 SASI_Mm01_00131280 predicted 1057
9 SASI_Mm01_00131281 predicted 691
10 SASI_Mm02_00324176 predicted 1027
11 SASI_Mm01_00131278 predicted 927
12 SASI_Mm01_00131279 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018827
VALIDATED
CRLF1 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018827.2-1320s21c1
Sequence:CCGGAGTCACACAAGACCCGAAACCCTCGAGGGTTTCGGGTCTTGTGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-1052s1c1
Sequence:CCGGTTCGTCCAAGTGCGTTGTAACCTCGAGGTTACAACGCACTTGGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-296s1c1
Sequence:CCGGCTGCAAGCTACCTGCTCTATACTCGAGTATAGAGCAGGTAGCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018827.2-422s1c1
Sequence:CCGGCTGGCCCTGGCTAACCTTAATCTCGAGATTAAGGTTAGCCAGGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-616s1c1
Sequence:CCGGGACATTCTTACATACCAACTACTCGAGTAGTTGGTATGTAAGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-1477s1c1
Sequence:CCGGGCAACAAAGAAACCTACCAGACTCGAGTCTGGTAGGTTTCTTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018827
VALIDATED
CRLF1 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018827.2-1320s21c1
Sequence:CCGGAGTCACACAAGACCCGAAACCCTCGAGGGTTTCGGGTCTTGTGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-1052s1c1
Sequence:CCGGTTCGTCCAAGTGCGTTGTAACCTCGAGGTTACAACGCACTTGGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-296s1c1
Sequence:CCGGCTGCAAGCTACCTGCTCTATACTCGAGTATAGAGCAGGTAGCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018827.2-422s1c1
Sequence:CCGGCTGGCCCTGGCTAACCTTAATCTCGAGATTAAGGTTAGCCAGGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-616s1c1
Sequence:CCGGGACATTCTTACATACCAACTACTCGAGTAGTTGGTATGTAAGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-1477s1c1
Sequence:CCGGGCAACAAAGAAACCTACCAGACTCGAGTCTGGTAGGTTTCTTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018827
VALIDATED
CRLF1 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018827.2-1320s21c1
Sequence:CCGGAGTCACACAAGACCCGAAACCCTCGAGGGTTTCGGGTCTTGTGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-1052s1c1
Sequence:CCGGTTCGTCCAAGTGCGTTGTAACCTCGAGGTTACAACGCACTTGGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.2-296s1c1
Sequence:CCGGCTGCAAGCTACCTGCTCTATACTCGAGTATAGAGCAGGTAGCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018827.2-422s1c1
Sequence:CCGGCTGGCCCTGGCTAACCTTAATCTCGAGATTAAGGTTAGCCAGGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-616s1c1
Sequence:CCGGGACATTCTTACATACCAACTACTCGAGTAGTTGGTATGTAAGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018827.1-1477s1c1
Sequence:CCGGGCAACAAAGAAACCTACCAGACTCGAGTCTGGTAGGTTTCTTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004750
VALIDATED
CRLF1 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-987s21c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-860s21c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-596s21c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-1139s21c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-987s1c1
Sequence:CCGGGCCCTCAAGGATTTCCTCTTTCTCGAGAAAGAGGAAATCCTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-996s1c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-869s1c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-1148s1c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-605s1c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004750
VALIDATED
CRLF1 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-987s21c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-860s21c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-596s21c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-1139s21c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-987s1c1
Sequence:CCGGGCCCTCAAGGATTTCCTCTTTCTCGAGAAAGAGGAAATCCTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-996s1c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-869s1c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-1148s1c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-605s1c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004750
VALIDATED
CRLF1 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-987s21c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-860s21c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-596s21c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004750.3-1139s21c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-987s1c1
Sequence:CCGGGCCCTCAAGGATTTCCTCTTTCTCGAGAAAGAGGAAATCCTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-996s1c1
Sequence:CCGGGATTTCCTCTTTCAAGCCAAACTCGAGTTTGGCTTGAAAGAGGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-869s1c1
Sequence:CCGGCGATGTACTCACGCTGGATATCTCGAGATATCCAGCGTGAGTACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004750.2-1148s1c1
Sequence:CCGGCTTTGGCATCTATGGCTCCAACTCGAGTTGGAGCCATAGATGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004750.2-605s1c1
Sequence:CCGGCCCAGAGAAACCCGTCAACATCTCGAGATGTTGACGGGTTTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)