EMAIL THIS PAGE TO A FRIEND

CRLF2

cytokine receptor-like factor 2

63 Gene Product Result for
Synonyms: CRL2 CRLF2Y TSLPR
UniProtKB ID: Q9HC73, Q9H5R3
Gene ID:
Human(64109) Summary: The protein encoded by this gene is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(57914) cytokine receptor-like factor 2
Rat(171499) cytokine receptor-like factor 2
domestic cat(101100367) cytokine receptor-like factor 2
dog(491709) cytokine receptor-like factor 2
naked mole-rat(101702063) cytokine receptor-like factor 2
sheep(101113732) cytokine receptor-like factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1763 Human TSLP R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012288 Rosetta Predictions human pricing
NM_022148 Rosetta Predictions human pricing
NM_134465 Rosetta Predictions rat pricing
NM_016715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211981 predicted 362
2 SASI_Hs01_00211982 predicted 389
3 SASI_Hs01_00211983 predicted 420
4 SASI_Hs01_00211984 predicted 416
5 SASI_Hs01_00211985 predicted 424
6 SASI_Hs01_00211986 predicted 416
7 SASI_Hs01_00211987 predicted 369
8 SASI_Hs01_00211988 predicted 333
9 SASI_Hs01_00211989 predicted 357
10 SASI_Hs01_00211990 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133090 predicted 484
2 SASI_Hs01_00133091 predicted 514
3 SASI_Hs01_00133092 predicted 542
4 SASI_Hs01_00133093 predicted 532
5 SASI_Hs01_00133094 predicted 550
6 SASI_Hs01_00133095 predicted 540
7 SASI_Hs01_00133096 predicted 483
8 SASI_Hs01_00133097 predicted 452
9 SASI_Hs01_00133098 predicted 477
10 SASI_Hs01_00133099 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037116 predicted 282
2 SASI_Rn02_00268068 predicted 420
3 SASI_Rn01_00037117 predicted 414
4 SASI_Rn01_00037118 predicted 328
5 SASI_Rn01_00037119 predicted 417
6 SASI_Rn01_00037120 predicted 243
7 SASI_Rn01_00037121 predicted 292
8 SASI_Rn01_00037122 predicted 259
9 SASI_Rn01_00037123 predicted 534
10 SASI_Rn02_00268069 predicted 1029
11 SASI_Rn01_00037124 predicted 277
12 SASI_Rn01_00037125 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046367 predicted 360
2 SASI_Mm01_00046368 predicted 410
3 SASI_Mm01_00046369 predicted 414
4 SASI_Mm01_00046370 predicted 1008
5 SASI_Mm01_00046371 predicted 386
6 SASI_Mm01_00046372 predicted 987
7 SASI_Mm01_00046373 predicted 503
8 SASI_Mm01_00046374 predicted 1036
9 SASI_Mm01_00046375 predicted 364
10 SASI_Mm02_00323407 predicted 479
11 SASI_Mm01_00046366 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016715
VALIDATED
CRLF2 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016715.2-1180s1c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-636s1c1
Sequence:CCGGCGCTGCTATGACTTCCGGGTTCTCGAGAACCCGGAAGTCATAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-251s1c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016715.2-262s1c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-926s1c1
Sequence:CCGGCTTTGAGAAGCATCACGGGAACTCGAGTTCCCGTGATGCTTCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-467s21c1
Sequence:CCGGACCTTGGAATGTGACGCTGCTCTCGAGAGCAGCGTCACATTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-963s21c1
Sequence:CCGGGAGGAGGAAGATGACCTCATCCTCGAGGATGAGGTCATCTTCCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-215s21c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-226s21c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-1144s21c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-194s21c1
Sequence:CCGGTGTCACAGTCGTCTGCCATGACTCGAGTCATGGCAGACGACTGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-414s21c1
Sequence:CCGGGCCATGGTGTTTAAGGCTAGGCTCGAGCCTAGCCTTAAACACCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016715.4-566s21c1
Sequence:CCGGGGAGAGCAATGACGATGAGGACTCGAGTCCTCATCGTCATTGCTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-822s21c1
Sequence:CCGGAGGCTTCGCAGGGTGAAAGATCTCGAGATCTTTCACCCTGCGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016715
VALIDATED
CRLF2 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016715.2-1180s1c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-636s1c1
Sequence:CCGGCGCTGCTATGACTTCCGGGTTCTCGAGAACCCGGAAGTCATAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-251s1c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016715.2-262s1c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-926s1c1
Sequence:CCGGCTTTGAGAAGCATCACGGGAACTCGAGTTCCCGTGATGCTTCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-467s21c1
Sequence:CCGGACCTTGGAATGTGACGCTGCTCTCGAGAGCAGCGTCACATTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-963s21c1
Sequence:CCGGGAGGAGGAAGATGACCTCATCCTCGAGGATGAGGTCATCTTCCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-215s21c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-226s21c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-1144s21c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-194s21c1
Sequence:CCGGTGTCACAGTCGTCTGCCATGACTCGAGTCATGGCAGACGACTGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-414s21c1
Sequence:CCGGGCCATGGTGTTTAAGGCTAGGCTCGAGCCTAGCCTTAAACACCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016715.4-566s21c1
Sequence:CCGGGGAGAGCAATGACGATGAGGACTCGAGTCCTCATCGTCATTGCTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-822s21c1
Sequence:CCGGAGGCTTCGCAGGGTGAAAGATCTCGAGATCTTTCACCCTGCGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016715
VALIDATED
CRLF2 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016715.2-1180s1c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-636s1c1
Sequence:CCGGCGCTGCTATGACTTCCGGGTTCTCGAGAACCCGGAAGTCATAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-251s1c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016715.2-262s1c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016715.2-926s1c1
Sequence:CCGGCTTTGAGAAGCATCACGGGAACTCGAGTTCCCGTGATGCTTCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-467s21c1
Sequence:CCGGACCTTGGAATGTGACGCTGCTCTCGAGAGCAGCGTCACATTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-963s21c1
Sequence:CCGGGAGGAGGAAGATGACCTCATCCTCGAGGATGAGGTCATCTTCCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-215s21c1
Sequence:CCGGCGCCAACTTGAGCCTGGAGTTCTCGAGAACTCCAGGCTCAAGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-226s21c1
Sequence:CCGGGCCTGGAGTTCCGTTATGGTACTCGAGTACCATAACGGAACTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-1144s21c1
Sequence:CCGGCTTGAAGTCACTGCCAGTCTACTCGAGTAGACTGGCAGTGACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-194s21c1
Sequence:CCGGTGTCACAGTCGTCTGCCATGACTCGAGTCATGGCAGACGACTGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.4-414s21c1
Sequence:CCGGGCCATGGTGTTTAAGGCTAGGCTCGAGCCTAGCCTTAAACACCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016715.4-566s21c1
Sequence:CCGGGGAGAGCAATGACGATGAGGACTCGAGTCCTCATCGTCATTGCTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016715.3-822s21c1
Sequence:CCGGAGGCTTCGCAGGGTGAAAGATCTCGAGATCTTTCACCCTGCGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022148
CRLF2 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-689s1c1
Sequence:CCGGCCCAAACCAAAGCTGTCCAAACTCGAGTTTGGACAGCTTTGGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-757s1c1
Sequence:CCGGCCTTCTGTCTTTATGGAAATTCTCGAGAATTTCCATAAAGACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-524s1c1
Sequence:CCGGGTCACCATAGAAGGCTTGGATCTCGAGATCCAAGCCTTCTATGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-181s1c1
Sequence:CCGGCCTGACTTTCCACTACAGATTCTCGAGAATCTGTAGTGGAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-286s1c1
Sequence:CCGGGCGAGACGACATTCTCTATTTCTCGAGAAATAGAGAATGTCGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022148.2-342s21c1
Sequence:CCGGCAAGTCGCTGGATGGTTTATTCTCGAGAATAAACCATCCAGCGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1159s21c1
Sequence:CCGGTCAGGATCCACGTTGACATTTCTCGAGAAATGTCAACGTGGATCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1359s21c1
Sequence:CCGGCAATTGCTCCAGGAGATTTACCTCGAGGTAAATCTCCTGGAGCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022148
CRLF2 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-689s1c1
Sequence:CCGGCCCAAACCAAAGCTGTCCAAACTCGAGTTTGGACAGCTTTGGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-757s1c1
Sequence:CCGGCCTTCTGTCTTTATGGAAATTCTCGAGAATTTCCATAAAGACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-524s1c1
Sequence:CCGGGTCACCATAGAAGGCTTGGATCTCGAGATCCAAGCCTTCTATGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-181s1c1
Sequence:CCGGCCTGACTTTCCACTACAGATTCTCGAGAATCTGTAGTGGAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-286s1c1
Sequence:CCGGGCGAGACGACATTCTCTATTTCTCGAGAAATAGAGAATGTCGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022148.2-342s21c1
Sequence:CCGGCAAGTCGCTGGATGGTTTATTCTCGAGAATAAACCATCCAGCGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1159s21c1
Sequence:CCGGTCAGGATCCACGTTGACATTTCTCGAGAAATGTCAACGTGGATCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1359s21c1
Sequence:CCGGCAATTGCTCCAGGAGATTTACCTCGAGGTAAATCTCCTGGAGCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022148
CRLF2 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-689s1c1
Sequence:CCGGCCCAAACCAAAGCTGTCCAAACTCGAGTTTGGACAGCTTTGGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-757s1c1
Sequence:CCGGCCTTCTGTCTTTATGGAAATTCTCGAGAATTTCCATAAAGACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-524s1c1
Sequence:CCGGGTCACCATAGAAGGCTTGGATCTCGAGATCCAAGCCTTCTATGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-181s1c1
Sequence:CCGGCCTGACTTTCCACTACAGATTCTCGAGAATCTGTAGTGGAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022148.2-286s1c1
Sequence:CCGGGCGAGACGACATTCTCTATTTCTCGAGAAATAGAGAATGTCGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022148.2-342s21c1
Sequence:CCGGCAAGTCGCTGGATGGTTTATTCTCGAGAATAAACCATCCAGCGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1159s21c1
Sequence:CCGGTCAGGATCCACGTTGACATTTCTCGAGAAATGTCAACGTGGATCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022148.2-1359s21c1
Sequence:CCGGCAATTGCTCCAGGAGATTTACCTCGAGGTAAATCTCCTGGAGCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)