EMAIL THIS PAGE TO A FRIEND

CRLF3

cytokine receptor-like factor 3

50 Gene Product Result for
Synonyms: CREME-9 CREME9 CRLM9 CYTOR4 FRWS p48.2
UniProtKB ID: Q8IUI8, A6NJF3, B2R8C3, Q2MLY7, Q9UNI3, Q9Y6M8
Gene ID:
Human(51379) Summary: This gene encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase. Studies of the related rat protein suggest that it may regulate neuronal morphology and synaptic vesicle biogenesis. This gene is one of several genes located in the neurofibromatosis type I tumor suppressor region on the q arm of chromosome 17, a region that is subject to microdeletions, duplications, chromosomal breaks and rearrangements. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2 and 5. [provided by RefSeq, Aug 2012]
Mouse(54394) cytokine receptor-like factor 3
Rat(54395) cytokine receptor-like factor 3
sheep(101116414) cytokine receptor-like factor 3
domestic guinea pig(100719691) cytokine receptor-like factor 3
naked mole-rat(101721491) cytokine receptor-like factor 3
Zebrafish(550515) cytokine receptor-like factor 3
domestic cat(101089811) cytokine receptor-like factor 3
cow(528033) cytokine receptor-like factor 3
Horse(100071822) cytokine receptor-like factor 3
dog(491157) cytokine receptor-like factor 3
chicken(417407) cytokine receptor-like factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015986 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015986 Rosetta Predictions human pricing
XM_001080961 Rosetta Predictions rat pricing
NM_018776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348660 predicted 1278
2 SASI_Hs02_00348661 predicted 429
3 SASI_Hs02_00348662 predicted 1253
4 SASI_Hs02_00348663 predicted 825
5 SASI_Hs02_00348664 predicted 410
6 SASI_Hs01_00187793 predicted 1026
7 SASI_Hs01_00187794 predicted 1147
8 SASI_Hs01_00187795 predicted 909
9 SASI_Hs02_00348665 predicted 1046
10 SASI_Hs02_00348666 predicted 1048
11 SASI_Hs01_00187786 predicted 1282
12 SASI_Hs01_00187787 predicted 1138
13 SASI_Hs01_00187788 predicted 1211
14 SASI_Hs01_00187789 predicted 1275
15 SASI_Hs01_00187790 predicted 269
16 SASI_Hs01_00187791 predicted 1452
17 SASI_Hs01_00187792 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370034 predicted 1279
2 SASI_Rn02_00370035 predicted 1045
3 SASI_Rn02_00370036 predicted 322
4 SASI_Rn02_00370037 predicted 669
5 SASI_Rn02_00370038 predicted 436
6 SASI_Rn02_00370039 predicted 749
7 SASI_Rn02_00370040 predicted 586
8 SASI_Rn02_00370041 predicted 1124
9 SASI_Rn02_00370042 predicted 1319
10 SASI_Rn02_00370043 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034998 predicted 1151
2 SASI_Mm01_00034999 predicted 197
3 SASI_Mm02_00324087 predicted 536
4 SASI_Mm01_00035000 predicted 307
5 SASI_Mm01_00035001 predicted 693
6 SASI_Mm01_00035002 predicted 997
7 SASI_Mm01_00035004 predicted 622
8 SASI_Mm01_00035005 predicted 743
9 SASI_Mm01_00035006 predicted 546
10 SASI_Mm01_00035007 predicted 463
11 SASI_Mm01_00035003 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015986
VALIDATED
CRLF3 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-962s21c1
Sequence:CCGGAGTCTGAGCAGTCGAAGAAATCTCGAGATTTCTTCGACTGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-1024s21c1
Sequence:CCGGCTCCAGAGCTCCGACTTATTTCTCGAGAAATAAGTCGGAGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-357s21c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-653s21c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-986s21c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-566s1c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-816s1c1
Sequence:CCGGCCCAGATAGGTCATTCCACATCTCGAGATGTGGAATGACCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-1073s1c1
Sequence:CCGGGCTGTGTGCATTAGTACAAATCTCGAGATTTGTACTAATGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-899s1c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-270s1c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015986
VALIDATED
CRLF3 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-962s21c1
Sequence:CCGGAGTCTGAGCAGTCGAAGAAATCTCGAGATTTCTTCGACTGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-1024s21c1
Sequence:CCGGCTCCAGAGCTCCGACTTATTTCTCGAGAAATAAGTCGGAGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-357s21c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-653s21c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-986s21c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-566s1c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-816s1c1
Sequence:CCGGCCCAGATAGGTCATTCCACATCTCGAGATGTGGAATGACCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-1073s1c1
Sequence:CCGGGCTGTGTGCATTAGTACAAATCTCGAGATTTGTACTAATGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-899s1c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-270s1c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015986
VALIDATED
CRLF3 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-962s21c1
Sequence:CCGGAGTCTGAGCAGTCGAAGAAATCTCGAGATTTCTTCGACTGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-1024s21c1
Sequence:CCGGCTCCAGAGCTCCGACTTATTTCTCGAGAAATAAGTCGGAGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-357s21c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-653s21c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015986.3-986s21c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-566s1c1
Sequence:CCGGCCAGTACAGATAGAAGAACTACTCGAGTAGTTCTTCTATCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015986.2-816s1c1
Sequence:CCGGCCCAGATAGGTCATTCCACATCTCGAGATGTGGAATGACCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-1073s1c1
Sequence:CCGGGCTGTGTGCATTAGTACAAATCTCGAGATTTGTACTAATGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-899s1c1
Sequence:CCGGGCACTTCGGAACGATTCTGAACTCGAGTTCAGAATCGTTCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015986.2-270s1c1
Sequence:CCGGCCATTGAACAGGAGACCATTACTCGAGTAATGGTCTCCTGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018776
VALIDATED
CRLF3 MISSION shRNA Bacterial Glycerol Stock
cytokine receptor-like factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-523s21c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-325s21c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018776.1-1417s21c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-1001s21c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-701s21c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-523s1c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-701s1c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-325s1c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018776.1-1001s1c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018776.1-1417s1c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018776
VALIDATED
CRLF3 MISSION shRNA shRNA Plasmid DNA
cytokine receptor-like factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-523s21c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-325s21c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018776.1-1417s21c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-1001s21c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-701s21c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-523s1c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-701s1c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-325s1c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018776.1-1001s1c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018776.1-1417s1c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018776
VALIDATED
CRLF3 MISSION shRNA Lentiviral Transduction Particles
cytokine receptor-like factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-523s21c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-325s21c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018776.1-1417s21c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-1001s21c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018776.1-701s21c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-523s1c1
Sequence:CCGGGCTCAGTTGGACGATTCCATTCTCGAGAATGGAATCGTCCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-701s1c1
Sequence:CCGGGCAAATGTACTGCAAATCATTCTCGAGAATGATTTGCAGTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018776.1-325s1c1
Sequence:CCGGCCACTAGATGACTGCCAGAAACTCGAGTTTCTGGCAGTCATCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018776.1-1001s1c1
Sequence:CCGGCGCTGACATTCAGAGTTGAAACTCGAGTTTCAACTCTGAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018776.1-1417s1c1
Sequence:CCGGGCTGTTTCTGTCCTCAGTTTACTCGAGTAAACTGAGGACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks