EMAIL THIS PAGE TO A FRIEND

CRLS1

cardiolipin synthase 1

93 Gene Product Result for
Synonyms: C20orf155 CLS CLS1 GCD10 dJ967N21.6
UniProtKB ID: Q9UJA2, D3DW09, E9PAT4, Q27RP0, Q69YQ5
Gene ID:
Mouse(66586) cardiolipin synthase 1
Rat(366196) cardiolipin synthase 1
Zebrafish(405867) cardiolipin synthase 1
chicken(428559) cardiolipin synthase 1
cow(512761) cardiolipin synthase 1
domestic cat(101081971) cardiolipin synthase 1
dog(607530) cardiolipin synthase 1
naked mole-rat(101720146) cardiolipin synthase 1
domestic guinea pig(100733538) cardiolipin synthase 1
sheep(101116926) cardiolipin synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303500 ANTI-CRLS1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2501839 Anti-CRLS1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, mouse, rat, canine, bovine
ELISA, western blot pricing
SAB2105727 Anti-CRLS1 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127458 Rosetta Predictions human pricing
NM_019095 Rosetta Predictions human pricing
NM_001014258 Rosetta Predictions rat pricing
NM_001024385 Rosetta Predictions mouse pricing
NM_025646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329584 predicted 404
2 SASI_Hs02_00329585 predicted 513
3 SASI_Hs02_00329586 predicted 729
4 SASI_Hs02_00329587 predicted 642
5 SASI_Hs02_00329588 predicted 631
6 SASI_Hs02_00329589 predicted 728
7 SASI_Hs02_00329590 predicted 578
8 SASI_Hs02_00329591 predicted 414
9 SASI_Hs02_00329592 predicted 575
10 SASI_Hs02_00329593 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168771 predicted 708
2 SASI_Hs01_00168772 predicted 813
3 SASI_Hs02_00352707 predicted 1030
4 SASI_Hs02_00352708 predicted 941
5 SASI_Hs01_00168773 predicted 939
6 SASI_Hs02_00352709 predicted 1029
7 SASI_Hs01_00168775 predicted 883
8 SASI_Hs01_00168776 predicted 714
9 SASI_Hs02_00352710 predicted 878
10 SASI_Hs02_00352711 predicted 814
11 SASI_Hs01_00168770 predicted 344
12 SASI_Hs01_00168774 predicted 596
13 SASI_Hs01_00168777 predicted 449
14 SASI_Hs01_00168778 predicted 440
15 SASI_Hs01_00168779 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045569 predicted 916
2 SASI_Rn01_00045570 predicted 684
3 SASI_Rn01_00045571 predicted 707
4 SASI_Rn01_00045572 predicted 861
5 SASI_Rn01_00045573 predicted 934
6 SASI_Rn01_00045574 predicted 738
7 SASI_Rn01_00045575 predicted 589
8 SASI_Rn01_00045578 predicted 552
9 SASI_Rn02_00201827 predicted 963
10 SASI_Rn02_00201828 predicted 1019
11 SASI_Rn01_00045576 predicted 456
12 SASI_Rn01_00045577 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192415 predicted 938
2 SASI_Mm01_00192416 predicted 693
3 SASI_Mm01_00192418 predicted 1000
4 SASI_Mm01_00192419 predicted 958
5 SASI_Mm02_00287575 predicted 998
6 SASI_Mm01_00192420 predicted 989
7 SASI_Mm01_00192421 predicted 997
8 SASI_Mm01_00192422 predicted 697
9 SASI_Mm01_00192423 predicted 876
10 SASI_Mm01_00192424 predicted 830
11 SASI_Mm01_00192417 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094092 predicted 620
2 SASI_Mm01_00094093 predicted 388
3 SASI_Mm01_00094095 predicted 682
4 SASI_Mm01_00094096 predicted 644
5 SASI_Mm02_00328753 predicted 678
6 SASI_Mm01_00094097 predicted 669
7 SASI_Mm01_00094098 predicted 676
8 SASI_Mm01_00094099 predicted 392
9 SASI_Mm01_00094100 predicted 561
10 SASI_Mm01_00094101 predicted 518
11 SASI_Mm01_00094094 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019095
VALIDATED
CRLS1 MISSION shRNA Bacterial Glycerol Stock
cardiolipin synthase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-562s1c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-922s1c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-621s1c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-337s1c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-563s1c1
Sequence:CCGGCTTGACCTATGCAGATCTTATCTCGAGATAAGATCTGCATAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-702s21c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-477s21c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-761s21c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019095.4-1062s21c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019095
VALIDATED
CRLS1 MISSION shRNA shRNA Plasmid DNA
cardiolipin synthase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-562s1c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-922s1c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-621s1c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-337s1c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-563s1c1
Sequence:CCGGCTTGACCTATGCAGATCTTATCTCGAGATAAGATCTGCATAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-702s21c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-477s21c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-761s21c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019095.4-1062s21c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019095
VALIDATED
CRLS1 MISSION shRNA Lentiviral Transduction Particles
cardiolipin synthase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-562s1c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-922s1c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-621s1c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-337s1c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019095.3-563s1c1
Sequence:CCGGCTTGACCTATGCAGATCTTATCTCGAGATAAGATCTGCATAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-702s21c1
Sequence:CCGGGCTTGACCTATGCAGATCTTACTCGAGTAAGATCTGCATAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-477s21c1
Sequence:CCGGCAATCCCGAATATGTTGTCAACTCGAGTTGACAACATATTCGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019095.4-761s21c1
Sequence:CCGGGTAATGTTGATTGCTGCTGTTCTCGAGAACAGCAGCAATCAACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019095.4-1062s21c1
Sequence:CCGGGAAAGTCATCCCTCACTGTTACTCGAGTAACAGTGAGGGATGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024385
VALIDATED
CRLS1 MISSION shRNA Bacterial Glycerol Stock
cardiolipin synthase 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024385.1-730s1c1
Sequence:CCGGCCCACTCACTTACATGATAATCTCGAGATTATCATGTAAGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-591s1c1
Sequence:CCGGCGGATTTGTTGGATGGATTTACTCGAGTAAATCCATCCAACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024385.1-1754s1c1
Sequence:CCGGCCTGTTTGTAATGGGATGTTTCTCGAGAAACATCCCATTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-545s1c1
Sequence:CCGGGAAGACTTTAATGTTGCACTACTCGAGTAGTGCAACATTAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-1001s1c1
Sequence:CCGGGCATCAGCATACAGTTATTATCTCGAGATAATAACTGTATGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024385.1-871s21c1
Sequence:CCGGATTCATCAGCAAGGTAAATACCTCGAGGTATTTACCTTGCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024385
VALIDATED
CRLS1 MISSION shRNA shRNA Plasmid DNA
cardiolipin synthase 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024385.1-730s1c1
Sequence:CCGGCCCACTCACTTACATGATAATCTCGAGATTATCATGTAAGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-591s1c1
Sequence:CCGGCGGATTTGTTGGATGGATTTACTCGAGTAAATCCATCCAACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024385.1-1754s1c1
Sequence:CCGGCCTGTTTGTAATGGGATGTTTCTCGAGAAACATCCCATTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-545s1c1
Sequence:CCGGGAAGACTTTAATGTTGCACTACTCGAGTAGTGCAACATTAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-1001s1c1
Sequence:CCGGGCATCAGCATACAGTTATTATCTCGAGATAATAACTGTATGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024385.1-871s21c1
Sequence:CCGGATTCATCAGCAAGGTAAATACCTCGAGGTATTTACCTTGCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024385
VALIDATED
CRLS1 MISSION shRNA Lentiviral Transduction Particles
cardiolipin synthase 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024385.1-730s1c1
Sequence:CCGGCCCACTCACTTACATGATAATCTCGAGATTATCATGTAAGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-591s1c1
Sequence:CCGGCGGATTTGTTGGATGGATTTACTCGAGTAAATCCATCCAACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024385.1-1754s1c1
Sequence:CCGGCCTGTTTGTAATGGGATGTTTCTCGAGAAACATCCCATTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-545s1c1
Sequence:CCGGGAAGACTTTAATGTTGCACTACTCGAGTAGTGCAACATTAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024385.1-1001s1c1
Sequence:CCGGGCATCAGCATACAGTTATTATCTCGAGATAATAACTGTATGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024385.1-871s21c1
Sequence:CCGGATTCATCAGCAAGGTAAATACCTCGAGGTATTTACCTTGCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks