EMAIL THIS PAGE TO A FRIEND

CRMP1

collapsin response mediator protein 1

138 Gene Product Result for
Synonyms: CRMP-1 DPYSL1 DRP-1 DRP1 ULIP-3
UniProtKB ID: Q14194, A0EJG6, Q13024, Q4W5F1, Q96TC8
Gene ID:
Human(1400) Summary: This gene encodes a member of a family of cytosolic phosphoproteins expressed exclusively in the nervous system. The encoded protein is thought to be a part of the semaphorin signal transduction pathway implicated in semaphorin-induced growth cone collapse during neural development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(12933) collapsin response mediator protein 1
Rat(25415) collapsin response mediator protein 1
Zebrafish(553756) collapsin response mediator protein 1
chicken(395156) collapsin response mediator protein 1
dog(479097) collapsin response mediator protein 1
domestic cat(101100051) collapsin response mediator protein 1
cow(504250) collapsin response mediator protein 1
Horse(100070014) collapsin response mediator protein 1
sheep(101102645) collapsin response mediator protein 1
Domestic Rabbit(100350067) collapsin response mediator protein 1
domestic guinea pig(100726092) collapsin response mediator protein 1
naked mole-rat(101709135) collapsin response mediator protein 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41932 Anti-CRMP1 (AB1) antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, guinea pig, canine, zebrafish, horse, human, rabbit
immunohistochemistry, western blot pricing
AV41934 Anti-CRMP1 (AB2) antibody produced in rabbit affinity isolated antibody human, zebrafish, guinea pig, bovine, canine, horse, mouse, rat, rabbit
western blot pricing
C4118 Anti-CRMP1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
C2868 Anti-CRMP1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB2100485 Anti-CRMP1 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, rat, human, zebrafish, mouse, horse, bovine, canine
western blot pricing
SAB3500201 Anti-CRMP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA035640 Anti-CRMP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402156 Monoclonal Anti-CRMP1 antibody produced in mouse clone 2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014809 Rosetta Predictions human pricing
NM_001313 Rosetta Predictions human pricing
NM_012932 Rosetta Predictions rat pricing
NM_007765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221782 predicted 1488
2 SASI_Hs01_00221783 predicted 771
3 SASI_Hs01_00221784 predicted 933
4 SASI_Hs02_00306574 predicted 1978
5 SASI_Hs01_00221786 predicted 1157
6 SASI_Hs01_00221788 predicted 2178
7 SASI_Hs01_00221789 predicted 1697
8 SASI_Hs01_00221790 predicted 963
9 SASI_Hs01_00221791 predicted 1169
10 SASI_Hs02_00306575 predicted 1028
11 SASI_Hs01_00221785 predicted 1591
12 SASI_Hs01_00221787 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210349 predicted 1381
2 SASI_Hs01_00210350 predicted 664
3 SASI_Hs01_00210351 predicted 820
4 SASI_Hs02_00331602 predicted 1873
5 SASI_Hs01_00210353 predicted 1047
6 SASI_Hs01_00210355 predicted 2069
7 SASI_Hs01_00210356 predicted 1589
8 SASI_Hs01_00210357 predicted 859
9 SASI_Hs01_00210358 predicted 1066
10 SASI_Hs02_00331603 predicted 918
11 SASI_Hs01_00210352 predicted 1476
12 SASI_Hs01_00210354 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096673 predicted 1490
2 SASI_Rn01_00096674 predicted 519
3 SASI_Rn01_00096675 predicted 319
4 SASI_Rn02_00260480 predicted 879
5 SASI_Rn01_00096676 predicted 616
6 SASI_Rn01_00096677 predicted 939
7 SASI_Rn01_00096678 predicted 1407
8 SASI_Rn01_00096680 predicted 1777
9 SASI_Rn02_00260481 predicted 1204
10 SASI_Rn01_00096681 predicted 1871
11 SASI_Rn01_00096679 predicted 1273
12 SASI_Rn01_00096682 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135234 predicted 1393
2 SASI_Mm01_00135235 predicted 1610
3 SASI_Mm01_00135236 predicted 370
4 SASI_Mm01_00135237 predicted 353
5 SASI_Mm01_00135238 predicted 1065
6 SASI_Mm01_00135239 predicted 1536
7 SASI_Mm01_00135240 predicted 1902
8 SASI_Mm02_00312392 predicted 526
9 SASI_Mm01_00135241 predicted 763
10 SASI_Mm01_00135242 predicted 1994
11 SASI_Mm01_00135243 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001313
VALIDATED
CRMP1 MISSION shRNA Bacterial Glycerol Stock
collapsin response mediator protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-1925s21c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-828s21c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-802s21c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-389s21c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-282s1c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-1818s1c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-695s1c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-721s1c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001313.2-1455s1c1
Sequence:CCGGCCCGACAAGTTGAAGACCATACTCGAGTATGGTCTTCAACTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001313
VALIDATED
CRMP1 MISSION shRNA shRNA Plasmid DNA
collapsin response mediator protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-1925s21c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-828s21c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-802s21c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-389s21c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-282s1c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-1818s1c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-695s1c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-721s1c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001313.2-1455s1c1
Sequence:CCGGCCCGACAAGTTGAAGACCATACTCGAGTATGGTCTTCAACTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001313
VALIDATED
CRMP1 MISSION shRNA Lentiviral Transduction Particles
collapsin response mediator protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-1925s21c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-828s21c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-802s21c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001313.3-389s21c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-282s1c1
Sequence:CCGGCGGATCATCAACGATGACCAACTCGAGTTGGTCATCGTTGATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-1818s1c1
Sequence:CCGGCACCAGTCCAACTTCAGCTTACTCGAGTAAGCTGAAGTTGGACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-695s1c1
Sequence:CCGGCGTCAATTCCTTCCAAGTCTACTCGAGTAGACTTGGAAGGAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001313.2-721s1c1
Sequence:CCGGCCTATAAGGATGTCTACCAAACTCGAGTTTGGTAGACATCCTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001313.2-1455s1c1
Sequence:CCGGCCCGACAAGTTGAAGACCATACTCGAGTATGGTCTTCAACTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007765
VALIDATED
CRMP1 MISSION shRNA Bacterial Glycerol Stock
collapsin response mediator protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1538s1c1
Sequence:CCGGCCATAAATCAACTGTGGAGTACTCGAGTACTCCACAGTTGATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007765.3-846s1c1
Sequence:CCGGGTGATCTTAGTCCATGCAGAACTCGAGTTCTGCATGGACTAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1896s1c1
Sequence:CCGGGCCCAGATAGATGACAACAATCTCGAGATTGTTGTCATCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-374s1c1
Sequence:CCGGCCTAGAAGATGGACTCATAAACTCGAGTTTATGAGTCCATCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-758s1c1
Sequence:CCGGCCAAGTCTACATGGCGTATAACTCGAGTTATACGCCATGTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007765
VALIDATED
CRMP1 MISSION shRNA shRNA Plasmid DNA
collapsin response mediator protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1538s1c1
Sequence:CCGGCCATAAATCAACTGTGGAGTACTCGAGTACTCCACAGTTGATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007765.3-846s1c1
Sequence:CCGGGTGATCTTAGTCCATGCAGAACTCGAGTTCTGCATGGACTAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1896s1c1
Sequence:CCGGGCCCAGATAGATGACAACAATCTCGAGATTGTTGTCATCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-374s1c1
Sequence:CCGGCCTAGAAGATGGACTCATAAACTCGAGTTTATGAGTCCATCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-758s1c1
Sequence:CCGGCCAAGTCTACATGGCGTATAACTCGAGTTATACGCCATGTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007765
VALIDATED
CRMP1 MISSION shRNA Lentiviral Transduction Particles
collapsin response mediator protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1538s1c1
Sequence:CCGGCCATAAATCAACTGTGGAGTACTCGAGTACTCCACAGTTGATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007765.3-846s1c1
Sequence:CCGGGTGATCTTAGTCCATGCAGAACTCGAGTTCTGCATGGACTAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-1896s1c1
Sequence:CCGGGCCCAGATAGATGACAACAATCTCGAGATTGTTGTCATCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-374s1c1
Sequence:CCGGCCTAGAAGATGGACTCATAAACTCGAGTTTATGAGTCCATCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007765.3-758s1c1
Sequence:CCGGCCAAGTCTACATGGCGTATAACTCGAGTTATACGCCATGTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks