EMAIL THIS PAGE TO A FRIEND

CRNKL1

crooked neck pre-mRNA splicing factor-like 1 (Drosophila)

40 Gene Product Result for
Synonyms: CLF CRN Clf1 HCRN MSTP021 SYF3
Gene ID:
Human(51340) Summary: The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Mouse(66877) Crn, crooked neck-like 1 (Drosophila)
Rat(100910202) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Zebrafish(393920) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
cow(526536) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
domestic cat(101080882) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
dog(477137) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
chicken(421243) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
sheep(101102164) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
naked mole-rat(101724733) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
domestic guinea pig(100725143) crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016652 Rosetta Predictions human pricing
NM_025820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028265 predicted 1767
2 SASI_Hs01_00028266 predicted 1977
3 SASI_Hs01_00028267 predicted 2334
4 SASI_Hs01_00028269 predicted 2393
5 SASI_Hs01_00028270 predicted 1162
6 SASI_Hs01_00028271 predicted 1113
7 SASI_Hs01_00028272 predicted 899
8 SASI_Hs01_00028273 predicted 2008
9 SASI_Hs01_00028274 predicted 1504
10 SASI_Hs02_00349837 predicted 2379
11 SASI_Hs01_00028268 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053630 predicted 1679
2 SASI_Mm02_00329070 predicted 1792
3 SASI_Mm02_00329071 predicted 1694
4 SASI_Mm01_00053635 predicted 1708
5 SASI_Mm02_00329072 predicted 1215
6 SASI_Mm02_00329073 predicted 409
7 SASI_Mm02_00329074 predicted 1085
8 SASI_Mm02_00329075 predicted 268
9 SASI_Mm02_00329076 predicted 1414
10 SASI_Mm02_00329077 predicted 1465
11 SASI_Mm01_00053631 predicted 1812
12 SASI_Mm01_00053632 predicted 372
13 SASI_Mm01_00053633 predicted 1773
14 SASI_Mm01_00053634 predicted 1839
15 SASI_Mm01_00053636 predicted 252
16 SASI_Mm01_00053637 predicted 1298
17 SASI_Mm01_00053638 predicted 433
18 SASI_Mm01_00053639 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025820
VALIDATED
CRNKL1 MISSION shRNA Bacterial Glycerol Stock
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025820.1-2462s1c1
Sequence:CCGGCCAGGAATAGACACAGGTTTACTCGAGTAAACCTGTGTCTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-1208s1c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-2005s1c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025820.1-701s1c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-381s1c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025820.3-2349s21c1
Sequence:CCGGGTCCGAGCATTTCTAGCATTTCTCGAGAAATGCTAGAAATGCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-700s21c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-380s21c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-2004s21c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025820.3-1207s21c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025820
VALIDATED
CRNKL1 MISSION shRNA shRNA Plasmid DNA
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025820.1-2462s1c1
Sequence:CCGGCCAGGAATAGACACAGGTTTACTCGAGTAAACCTGTGTCTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-1208s1c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-2005s1c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025820.1-701s1c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-381s1c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025820.3-2349s21c1
Sequence:CCGGGTCCGAGCATTTCTAGCATTTCTCGAGAAATGCTAGAAATGCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-700s21c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-380s21c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-2004s21c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025820.3-1207s21c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025820
VALIDATED
CRNKL1 MISSION shRNA Lentiviral Transduction Particles
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025820.1-2462s1c1
Sequence:CCGGCCAGGAATAGACACAGGTTTACTCGAGTAAACCTGTGTCTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-1208s1c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-2005s1c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025820.1-701s1c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025820.1-381s1c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025820.3-2349s21c1
Sequence:CCGGGTCCGAGCATTTCTAGCATTTCTCGAGAAATGCTAGAAATGCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-700s21c1
Sequence:CCGGCGCACCATCTATGAACGCTTTCTCGAGAAAGCGTTCATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-380s21c1
Sequence:CCGGAGGAAATTCAAAGGGCTCGATCTCGAGATCGAGCCCTTTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025820.3-2004s21c1
Sequence:CCGGGTGGGAAGAATACTATGACTACTCGAGTAGTCATAGTATTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025820.3-1207s21c1
Sequence:CCGGCGCTACATCTACCTTTGGGTTCTCGAGAACCCAAAGGTAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016652
VALIDATED
CRNKL1 MISSION shRNA Bacterial Glycerol Stock
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016652.3-3019s1c1
Sequence:CCGGGCCAATAGTTTGACAGCTCATCTCGAGATGAGCTGTCAAACTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016652.3-2294s1c1
Sequence:CCGGGCTGGAATCTTGGCGAAGTTTCTCGAGAAACTTCGCCAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-830s1c1
Sequence:CCGGGCGTGCTTTAGATGTAGACTACTCGAGTAGTCTACATCTAAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-1119s1c1
Sequence:CCGGCGCACCATTTATGAGCGATTTCTCGAGAAATCGCTCATAAATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-1642s21c1
Sequence:CCGGGGATCAACTATGCACTCTATGCTCGAGCATAGAGTGCATAGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-806s21c1
Sequence:CCGGTCAAAGGGCTCGATCCATATACTCGAGTATATGGATCGAGCCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-1959s21c1
Sequence:CCGGTGGATTAAATTCGCTGAATTACTCGAGTAATTCAGCGAATTTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016652.4-2869s21c1
Sequence:CCGGTTTCATGTCATACCCATAAAGCTCGAGCTTTATGGGTATGACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-905s21c1
Sequence:CCGGAGTCAACCATGCTCGAAATATCTCGAGATATTTCGAGCATGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016652
VALIDATED
CRNKL1 MISSION shRNA shRNA Plasmid DNA
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016652.3-3019s1c1
Sequence:CCGGGCCAATAGTTTGACAGCTCATCTCGAGATGAGCTGTCAAACTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016652.3-2294s1c1
Sequence:CCGGGCTGGAATCTTGGCGAAGTTTCTCGAGAAACTTCGCCAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-830s1c1
Sequence:CCGGGCGTGCTTTAGATGTAGACTACTCGAGTAGTCTACATCTAAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-1119s1c1
Sequence:CCGGCGCACCATTTATGAGCGATTTCTCGAGAAATCGCTCATAAATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-1642s21c1
Sequence:CCGGGGATCAACTATGCACTCTATGCTCGAGCATAGAGTGCATAGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-806s21c1
Sequence:CCGGTCAAAGGGCTCGATCCATATACTCGAGTATATGGATCGAGCCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-1959s21c1
Sequence:CCGGTGGATTAAATTCGCTGAATTACTCGAGTAATTCAGCGAATTTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016652.4-2869s21c1
Sequence:CCGGTTTCATGTCATACCCATAAAGCTCGAGCTTTATGGGTATGACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-905s21c1
Sequence:CCGGAGTCAACCATGCTCGAAATATCTCGAGATATTTCGAGCATGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016652
VALIDATED
CRNKL1 MISSION shRNA Lentiviral Transduction Particles
crooked neck pre-mRNA splicing factor-like 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016652.3-3019s1c1
Sequence:CCGGGCCAATAGTTTGACAGCTCATCTCGAGATGAGCTGTCAAACTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016652.3-2294s1c1
Sequence:CCGGGCTGGAATCTTGGCGAAGTTTCTCGAGAAACTTCGCCAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-830s1c1
Sequence:CCGGGCGTGCTTTAGATGTAGACTACTCGAGTAGTCTACATCTAAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016652.3-1119s1c1
Sequence:CCGGCGCACCATTTATGAGCGATTTCTCGAGAAATCGCTCATAAATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-1642s21c1
Sequence:CCGGGGATCAACTATGCACTCTATGCTCGAGCATAGAGTGCATAGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016652.4-806s21c1
Sequence:CCGGTCAAAGGGCTCGATCCATATACTCGAGTATATGGATCGAGCCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-1959s21c1
Sequence:CCGGTGGATTAAATTCGCTGAATTACTCGAGTAATTCAGCGAATTTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016652.4-2869s21c1
Sequence:CCGGTTTCATGTCATACCCATAAAGCTCGAGCTTTATGGGTATGACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016652.4-905s21c1
Sequence:CCGGAGTCAACCATGCTCGAAATATCTCGAGATATTTCGAGCATGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks