EMAIL THIS PAGE TO A FRIEND

CRNN

cornulin

87 Gene Product Result for
Synonyms: C1orf10 DRC1 PDRC1 SEP53
UniProtKB ID: Q9UBG3, B2RE60, Q8N613
Gene ID:
Human(49860) Summary: This gene encodes a member of the 'fused gene' family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]
Mouse(381457) cornulin
Rat(295186) cornulin
sheep(101121219) cornulin
chicken(431307) cornulin
cow(100141268) cornulin
Horse(100055728) cornulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049801 MISSION® esiRNA esiRNA human CRNN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016190 Rosetta Predictions human pricing
XM_001055236 Rosetta Predictions rat pricing
XM_227367 Rosetta Predictions rat pricing
NM_001081200 Rosetta Predictions mouse pricing
XM_355410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349019 predicted 1586
2 SASI_Hs01_00077470 predicted 1364
3 SASI_Hs01_00077471 predicted 1026
4 SASI_Hs01_00077472 predicted 1545
5 SASI_Hs01_00077474 predicted 1578
6 SASI_Hs01_00077475 predicted 546
7 SASI_Hs01_00077476 predicted 273
8 SASI_Hs01_00077477 predicted 573
9 SASI_Hs02_00349020 predicted 1202
10 SASI_Hs02_00349021 predicted 689
11 SASI_Hs01_00077468 predicted 1507
12 SASI_Hs01_00077469 predicted 823
13 SASI_Hs01_00077473 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278926 predicted 210
2 SASI_Rn02_00278927 predicted 645
3 SASI_Rn02_00278928 predicted 1077
4 SASI_Rn02_00278929 predicted 1155
5 SASI_Rn02_00278930 predicted 521
6 SASI_Rn02_00278931 predicted 1310
7 SASI_Rn02_00278932 predicted 863
8 SASI_Rn02_00278933 predicted 265
9 SASI_Rn02_00278934 predicted 259
10 SASI_Rn02_00278935 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384313 predicted 213
2 SASI_Rn02_00384314 predicted 647
3 SASI_Rn02_00384315 predicted 1078
4 SASI_Rn02_00384316 predicted 1148
5 SASI_Rn02_00384317 predicted 522
6 SASI_Rn02_00384318 predicted 1307
7 SASI_Rn02_00384319 predicted 864
8 SASI_Rn02_00384320 predicted 273
9 SASI_Rn02_00384321 predicted 261
10 SASI_Rn02_00384322 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296171 predicted 332
2 SASI_Mm02_00296172 predicted 280
3 SASI_Mm02_00296173 predicted 1051
4 SASI_Mm02_00296174 predicted 324
5 SASI_Mm02_00296175 predicted 599
6 SASI_Mm02_00296176 predicted 713
7 SASI_Mm02_00296177 predicted 1215
8 SASI_Mm02_00296178 predicted 906
9 SASI_Mm02_00296179 predicted 519
10 SASI_Mm02_00296180 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220179 predicted 1375
2 SASI_Mm01_00220180 predicted 1064
3 SASI_Mm01_00220181 predicted 1042
4 SASI_Mm01_00220182 predicted 1160
5 SASI_Mm01_00220183 predicted 1383
6 SASI_Mm01_00220184 predicted 1217
7 SASI_Mm01_00220185 predicted 916
8 SASI_Mm01_00220186 predicted 824
9 SASI_Mm01_00220187 predicted 1120
10 SASI_Mm01_00220188 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016190
CRNN MISSION shRNA Bacterial Glycerol Stock
cornulin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1568s21c1
Sequence:CCGGCCGACTCCAATGTCCAGTACTCTCGAGAGTACTGGACATTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1652s21c1
Sequence:CCGGGGACATCAGCTCTTCATTATGCTCGAGCATAATGAAGAGCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1688s21c1
Sequence:CCGGGTCTTTCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1425s1c1
Sequence:CCGGGCAACTTGCATACCAGTGTTTCTCGAGAAACACTGGTATGCAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-649s1c1
Sequence:CCGGGAGGAATCAGACAACAGAGATCTCGAGATCTCTGTTGTCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1494s1c1
Sequence:CCGGTCACAGCTAGAGAGCTGTATTCTCGAGAATACAGCTCTCTAGCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-342s1c1
Sequence:CCGGGCGGCTCTCAAGAGTCTGGAACTCGAGTTCCAGACTCTTGAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-166s1c1
Sequence:CCGGGCAAGAGTTTGCCGATGTGATCTCGAGATCACATCGGCAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016190
CRNN MISSION shRNA shRNA Plasmid DNA
cornulin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1568s21c1
Sequence:CCGGCCGACTCCAATGTCCAGTACTCTCGAGAGTACTGGACATTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1652s21c1
Sequence:CCGGGGACATCAGCTCTTCATTATGCTCGAGCATAATGAAGAGCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1688s21c1
Sequence:CCGGGTCTTTCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1425s1c1
Sequence:CCGGGCAACTTGCATACCAGTGTTTCTCGAGAAACACTGGTATGCAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-649s1c1
Sequence:CCGGGAGGAATCAGACAACAGAGATCTCGAGATCTCTGTTGTCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1494s1c1
Sequence:CCGGTCACAGCTAGAGAGCTGTATTCTCGAGAATACAGCTCTCTAGCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-342s1c1
Sequence:CCGGGCGGCTCTCAAGAGTCTGGAACTCGAGTTCCAGACTCTTGAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-166s1c1
Sequence:CCGGGCAAGAGTTTGCCGATGTGATCTCGAGATCACATCGGCAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016190
CRNN MISSION shRNA Lentiviral Transduction Particles
cornulin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1568s21c1
Sequence:CCGGCCGACTCCAATGTCCAGTACTCTCGAGAGTACTGGACATTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1652s21c1
Sequence:CCGGGGACATCAGCTCTTCATTATGCTCGAGCATAATGAAGAGCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016190.2-1688s21c1
Sequence:CCGGGTCTTTCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1425s1c1
Sequence:CCGGGCAACTTGCATACCAGTGTTTCTCGAGAAACACTGGTATGCAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-649s1c1
Sequence:CCGGGAGGAATCAGACAACAGAGATCTCGAGATCTCTGTTGTCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-1494s1c1
Sequence:CCGGTCACAGCTAGAGAGCTGTATTCTCGAGAATACAGCTCTCTAGCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-342s1c1
Sequence:CCGGGCGGCTCTCAAGAGTCTGGAACTCGAGTTCCAGACTCTTGAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016190.1-166s1c1
Sequence:CCGGGCAAGAGTTTGCCGATGTGATCTCGAGATCACATCGGCAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081200
CRNN MISSION shRNA Bacterial Glycerol Stock
cornulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1034s21c1
Sequence:CCGGGGCACAGGGAGAGTCATATATCTCGAGATATATGACTCTCCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-181s21c1
Sequence:CCGGATGAGTTTGCTGACGTCATAGCTCGAGCTATGACGTCAGCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1382s21c1
Sequence:CCGGGACTGAGACAGACACTATTATCTCGAGATAATAGTGTCTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-771s21c1
Sequence:CCGGGGGTCTACCTGTGACTATAACCTCGAGGTTATAGTCACAGGTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1210s21c1
Sequence:CCGGAGACACAGGCAGGATCATATACTCGAGTATATGATCCTGCCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081200
CRNN MISSION shRNA shRNA Plasmid DNA
cornulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1034s21c1
Sequence:CCGGGGCACAGGGAGAGTCATATATCTCGAGATATATGACTCTCCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-181s21c1
Sequence:CCGGATGAGTTTGCTGACGTCATAGCTCGAGCTATGACGTCAGCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1382s21c1
Sequence:CCGGGACTGAGACAGACACTATTATCTCGAGATAATAGTGTCTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-771s21c1
Sequence:CCGGGGGTCTACCTGTGACTATAACCTCGAGGTTATAGTCACAGGTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1210s21c1
Sequence:CCGGAGACACAGGCAGGATCATATACTCGAGTATATGATCCTGCCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081200
CRNN MISSION shRNA Lentiviral Transduction Particles
cornulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1034s21c1
Sequence:CCGGGGCACAGGGAGAGTCATATATCTCGAGATATATGACTCTCCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-181s21c1
Sequence:CCGGATGAGTTTGCTGACGTCATAGCTCGAGCTATGACGTCAGCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1382s21c1
Sequence:CCGGGACTGAGACAGACACTATTATCTCGAGATAATAGTGTCTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-771s21c1
Sequence:CCGGGGGTCTACCTGTGACTATAACCTCGAGGTTATAGTCACAGGTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081200.1-1210s21c1
Sequence:CCGGAGACACAGGCAGGATCATATACTCGAGTATATGATCCTGCCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks