EMAIL THIS PAGE TO A FRIEND

CROCC

ciliary rootlet coiled-coil, rootletin

Synonyms: ROLT
UniProtKB ID: Q5TZA2, Q2VHY3, Q66GT7, Q7Z2L4, Q7Z5D7
Gene ID:
Mouse(230872) ciliary rootlet coiled-coil, rootletin
Rat(313663) ciliary rootlet coiled-coil, rootletin
chicken(428191) ciliary rootlet coiled-coil, rootletin
cow(530641) ciliary rootlet coiled-coil, rootletin
domestic cat(101086242) ciliary rootlet coiled-coil, rootletin
dog(487417) ciliary rootlet coiled-coil, rootletin
sheep(101109254) ciliary rootlet coiled-coil, rootletin
naked mole-rat(101718332) ciliary rootlet coiled-coil, rootletin
domestic guinea pig(100729648) ciliary rootlet coiled-coil, rootletin
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014675 Rosetta Predictions human pricing
NM_001107990 Rosetta Predictions rat pricing
NM_172122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230342 predicted 4936
2 SASI_Hs01_00230343 predicted 598
3 SASI_Hs01_00230344 predicted 5643
4 SASI_Hs01_00230345 predicted 5338
5 SASI_Hs01_00230346 predicted 4629
6 SASI_Hs01_00230347 predicted 5734
7 SASI_Hs02_00346028 predicted 6042
8 SASI_Hs01_00230348 predicted 205
9 SASI_Hs01_00230349 predicted 388
10 SASI_Hs01_00230350 predicted 5395
11 SASI_Hs01_00230341 predicted 3237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234275 predicted 1466
2 SASI_Rn02_00234276 predicted 2147
3 SASI_Rn02_00234277 predicted 1301
4 SASI_Rn02_00234278 predicted 1325
5 SASI_Rn02_00234279 predicted 2661
6 SASI_Rn02_00234280 predicted 2353
7 SASI_Rn02_00234281 predicted 2115
8 SASI_Rn02_00234282 predicted 2128
9 SASI_Rn02_00234283 predicted 1253
10 SASI_Rn02_00234284 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082411 predicted 1701
2 SASI_Mm01_00082412 predicted 2423
3 SASI_Mm01_00082413 predicted 5421
4 SASI_Mm01_00082414 predicted 5386
5 SASI_Mm01_00082415 predicted 410
6 SASI_Mm01_00082416 predicted 1260
7 SASI_Mm01_00082417 predicted 1986
8 SASI_Mm01_00082418 predicted 6100
9 SASI_Mm01_00082419 predicted 5306
10 SASI_Mm01_00082420 predicted 2868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014675
CROCC MISSION shRNA Bacterial Glycerol Stock
ciliary rootlet coiled-coil, rootletin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-3261s1c1
Sequence:CCGGGTCTCTGAAGGAGTCTGAGAACTCGAGTTCTCAGACTCCTTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4926s1c1
Sequence:CCGGCCAGGAGAAGATCAGCAAGATCTCGAGATCTTGCTGATCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-392s1c1
Sequence:CCGGCCATTAAGTACAATGCGGTCACTCGAGTGACCGCATTGTACTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4940s1c1
Sequence:CCGGGCAAGATGAAGGCCAATGAGACTCGAGTCTCATTGGCCTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4935s1c1
Sequence:CCGGGATCAGCAAGATGAAGGCCAACTCGAGTTGGCCTTCATCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-2922s21c1
Sequence:CCGGGCGGCAGCAAATAATAGCTACCTCGAGGTAGCTATTATTTGCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-774s21c1
Sequence:CCGGGAATGCCATGCTCCGAGAACACTCGAGTGTTCTCGGAGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-5347s21c1
Sequence:CCGGGAACATGACCGCCAAGTACTCCTCGAGGAGTACTTGGCGGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014675
CROCC MISSION shRNA shRNA Plasmid DNA
ciliary rootlet coiled-coil, rootletin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-3261s1c1
Sequence:CCGGGTCTCTGAAGGAGTCTGAGAACTCGAGTTCTCAGACTCCTTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4926s1c1
Sequence:CCGGCCAGGAGAAGATCAGCAAGATCTCGAGATCTTGCTGATCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-392s1c1
Sequence:CCGGCCATTAAGTACAATGCGGTCACTCGAGTGACCGCATTGTACTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4940s1c1
Sequence:CCGGGCAAGATGAAGGCCAATGAGACTCGAGTCTCATTGGCCTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4935s1c1
Sequence:CCGGGATCAGCAAGATGAAGGCCAACTCGAGTTGGCCTTCATCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-2922s21c1
Sequence:CCGGGCGGCAGCAAATAATAGCTACCTCGAGGTAGCTATTATTTGCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-774s21c1
Sequence:CCGGGAATGCCATGCTCCGAGAACACTCGAGTGTTCTCGGAGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-5347s21c1
Sequence:CCGGGAACATGACCGCCAAGTACTCCTCGAGGAGTACTTGGCGGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014675
CROCC MISSION shRNA Lentiviral Transduction Particles
ciliary rootlet coiled-coil, rootletin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-3261s1c1
Sequence:CCGGGTCTCTGAAGGAGTCTGAGAACTCGAGTTCTCAGACTCCTTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4926s1c1
Sequence:CCGGCCAGGAGAAGATCAGCAAGATCTCGAGATCTTGCTGATCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-392s1c1
Sequence:CCGGCCATTAAGTACAATGCGGTCACTCGAGTGACCGCATTGTACTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4940s1c1
Sequence:CCGGGCAAGATGAAGGCCAATGAGACTCGAGTCTCATTGGCCTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014675.2-4935s1c1
Sequence:CCGGGATCAGCAAGATGAAGGCCAACTCGAGTTGGCCTTCATCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-2922s21c1
Sequence:CCGGGCGGCAGCAAATAATAGCTACCTCGAGGTAGCTATTATTTGCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-774s21c1
Sequence:CCGGGAATGCCATGCTCCGAGAACACTCGAGTGTTCTCGGAGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014675.3-5347s21c1
Sequence:CCGGGAACATGACCGCCAAGTACTCCTCGAGGAGTACTTGGCGGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172122
CROCC MISSION shRNA Bacterial Glycerol Stock
ciliary rootlet coiled-coil, rootletin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-632s1c1
Sequence:CCGGCAGTACAAGAAGCAGTGCTCACTCGAGTGAGCACTGCTTCTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-412s1c1
Sequence:CCGGCATCAAGTACAATGCTGTCAACTCGAGTTGACAGCATTGTACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-2332s1c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172122.1-6238s1c1
Sequence:CCGGGAGTTGCTACAACCTGTACTACTCGAGTAGTACAGGTTGTAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-2332s21c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-405s21c1
Sequence:CCGGAGCTGGCCATCAAGTACAATGCTCGAGCATTGTACTTGATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172122.1-6228s21c1
Sequence:CCGGTGGCTTCTCAGAGTTGCTACACTCGAGTGTAGCAACTCTGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-5693s21c1
Sequence:CCGGCTCAGGAAGACGCTGGATAAGCTCGAGCTTATCCAGCGTCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-4065s21c1
Sequence:CCGGTACGGCAGAGGTTGCTGAAAGCTCGAGCTTTCAGCAACCTCTGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172122
CROCC MISSION shRNA shRNA Plasmid DNA
ciliary rootlet coiled-coil, rootletin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-632s1c1
Sequence:CCGGCAGTACAAGAAGCAGTGCTCACTCGAGTGAGCACTGCTTCTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-412s1c1
Sequence:CCGGCATCAAGTACAATGCTGTCAACTCGAGTTGACAGCATTGTACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-2332s1c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172122.1-6238s1c1
Sequence:CCGGGAGTTGCTACAACCTGTACTACTCGAGTAGTACAGGTTGTAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-2332s21c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-405s21c1
Sequence:CCGGAGCTGGCCATCAAGTACAATGCTCGAGCATTGTACTTGATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172122.1-6228s21c1
Sequence:CCGGTGGCTTCTCAGAGTTGCTACACTCGAGTGTAGCAACTCTGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-5693s21c1
Sequence:CCGGCTCAGGAAGACGCTGGATAAGCTCGAGCTTATCCAGCGTCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-4065s21c1
Sequence:CCGGTACGGCAGAGGTTGCTGAAAGCTCGAGCTTTCAGCAACCTCTGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172122
CROCC MISSION shRNA Lentiviral Transduction Particles
ciliary rootlet coiled-coil, rootletin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-632s1c1
Sequence:CCGGCAGTACAAGAAGCAGTGCTCACTCGAGTGAGCACTGCTTCTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-412s1c1
Sequence:CCGGCATCAAGTACAATGCTGTCAACTCGAGTTGACAGCATTGTACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172122.1-2332s1c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172122.1-6238s1c1
Sequence:CCGGGAGTTGCTACAACCTGTACTACTCGAGTAGTACAGGTTGTAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-2332s21c1
Sequence:CCGGCCAGGACAAGCTGGAATTAAACTCGAGTTTAATTCCAGCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-405s21c1
Sequence:CCGGAGCTGGCCATCAAGTACAATGCTCGAGCATTGTACTTGATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172122.1-6228s21c1
Sequence:CCGGTGGCTTCTCAGAGTTGCTACACTCGAGTGTAGCAACTCTGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-5693s21c1
Sequence:CCGGCTCAGGAAGACGCTGGATAAGCTCGAGCTTATCCAGCGTCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172122.1-4065s21c1
Sequence:CCGGTACGGCAGAGGTTGCTGAAAGCTCGAGCTTTCAGCAACCTCTGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks