EMAIL THIS PAGE TO A FRIEND

CROT

carnitine O-octanoyltransferase

96 Gene Product Result for
Synonyms: COT
UniProtKB ID: Q9UKG9, A4D1D6, E7EQF2, Q86V17, Q8IUW9, Q9Y6I2
Gene ID:
Human(54677) Summary: This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Mouse(74114) carnitine O-octanoyltransferase
Rat(83842) carnitine O-octanoyltransferase
Zebrafish(553204) carnitine O-octanoyltransferase
chicken(420533) carnitine O-octanoyltransferase
dog(482283) carnitine O-octanoyltransferase
cow(281092) carnitine O-octanoyltransferase
Horse(100050111) carnitine O-octanoyltransferase
domestic cat(101096799) carnitine O-octanoyltransferase
domestic guinea pig(100722629) carnitine O-octanoyltransferase
naked mole-rat(101716437) carnitine O-octanoyltransferase
sheep(101111626) carnitine O-octanoyltransferase
Domestic Rabbit(100355549) carnitine O-octanoyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021151 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021151 Rosetta Predictions human pricing
NM_031987 Rosetta Predictions rat pricing
NM_023733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177987 predicted 1132
2 SASI_Hs01_00177988 predicted 2008
3 SASI_Hs01_00177990 predicted 1020
4 SASI_Hs01_00177992 predicted 624
5 SASI_Hs02_00354690 predicted 1747
6 SASI_Hs01_00177993 predicted 745
7 SASI_Hs02_00354691 predicted 1401
8 SASI_Hs01_00177994 predicted 454
9 SASI_Hs01_00177995 predicted 1457
10 SASI_Hs02_00354692 predicted 1070
11 SASI_Hs01_00177989 predicted 1510
12 SASI_Hs01_00177991 predicted 1372
13 SASI_Hs01_00177996 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050913 predicted 1240
2 SASI_Rn02_00265385 predicted 1907
3 SASI_Rn01_00050914 predicted 313
4 SASI_Rn01_00050916 predicted 492
5 SASI_Rn01_00050918 predicted 426
6 SASI_Rn01_00050919 predicted 1051
7 SASI_Rn01_00050920 predicted 999
8 SASI_Rn02_00265386 predicted 1297
9 SASI_Rn01_00050921 predicted 568
10 SASI_Rn01_00050922 predicted 1372
11 SASI_Rn01_00050915 predicted 975
12 SASI_Rn01_00050917 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189404 predicted 1329
2 SASI_Mm01_00189405 predicted 284
3 SASI_Mm01_00189406 predicted 667
4 SASI_Mm01_00189407 predicted 608
5 SASI_Mm01_00189410 predicted 2010
6 SASI_Mm01_00189411 predicted 1479
7 SASI_Mm01_00189412 predicted 2099
8 SASI_Mm01_00189413 predicted 677
9 SASI_Mm02_00327311 predicted 803
10 SASI_Mm02_00327312 predicted 272
11 SASI_Mm01_00189408 predicted 972
12 SASI_Mm01_00189409 predicted 2078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023733
CROT MISSION shRNA Bacterial Glycerol Stock
carnitine O-octanoyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-236s21c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1960s21c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023733.3-2203s21c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-758s21c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1150s21c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023733.2-2204s1c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-237s1c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1961s1c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1151s1c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-759s1c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023733
CROT MISSION shRNA shRNA Plasmid DNA
carnitine O-octanoyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-236s21c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1960s21c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023733.3-2203s21c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-758s21c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1150s21c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023733.2-2204s1c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-237s1c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1961s1c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1151s1c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-759s1c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023733
CROT MISSION shRNA Lentiviral Transduction Particles
carnitine O-octanoyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-236s21c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1960s21c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023733.3-2203s21c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-758s21c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023733.3-1150s21c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023733.2-2204s1c1
Sequence:CCGGGCCTCAACAAAGCAAATCTATCTCGAGATAGATTTGCTTTGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-237s1c1
Sequence:CCGGCCTGCACTTGAAGAATCATTACTCGAGTAATGATTCTTCAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1961s1c1
Sequence:CCGGCCACGATATGATACAGCTGATCTCGAGATCAGCTGTATCATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-1151s1c1
Sequence:CCGGCGATGCAATGGTCATGGTGAACTCGAGTTCACCATGACCATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023733.2-759s1c1
Sequence:CCGGGCGTTTGTCTTTGATGTACTACTCGAGTAGTACATCAAAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021151
VALIDATED
CROT MISSION shRNA Bacterial Glycerol Stock
carnitine O-octanoyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-583s21c1
Sequence:GTACCGGTGAACTACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021151.2-2353s21c1
Sequence:CCGGTGGTACTTACATGGGTTATAACTCGAGTTATAACCCATGTAAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1425s21c1
Sequence:CCGGCTTCACCCGGATACGTTTATTCTCGAGAATAAACGTATCCGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1036s21c1
Sequence:CCGGATGTAACACCAGAGGATTATTCTCGAGAATAATCCTCTGGTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-994s21c1
Sequence:CCGGAGAGTAGTTTACTGGTATATTCTCGAGAATATACCAGTAAACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-939s1c1
Sequence:CCGGCGAGAATATCTGATTGGTCTTCTCGAGAAGACCAATCAGATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-1431s1c1
Sequence:CCGGCCGGATACGTTTATTCAGCTTCTCGAGAAGCTGAATAAACGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-450s1c1
Sequence:CCGGGCCTATCTGGATGTTCGTATACTCGAGTATACGAACATCCAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-617s1c1
Sequence:CCGGGCCTGTTCATAAAGTTGGAAACTCGAGTTTCCAACTTTATGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-1072s1c1
Sequence:CCGGCCATCCTTATTGGAGATCCAACTCGAGTTGGATCTCCAATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021151
VALIDATED
CROT MISSION shRNA shRNA Plasmid DNA
carnitine O-octanoyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-583s21c1
Sequence:GTACCGGTGAACTACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021151.2-2353s21c1
Sequence:CCGGTGGTACTTACATGGGTTATAACTCGAGTTATAACCCATGTAAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1425s21c1
Sequence:CCGGCTTCACCCGGATACGTTTATTCTCGAGAATAAACGTATCCGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1036s21c1
Sequence:CCGGATGTAACACCAGAGGATTATTCTCGAGAATAATCCTCTGGTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-994s21c1
Sequence:CCGGAGAGTAGTTTACTGGTATATTCTCGAGAATATACCAGTAAACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-939s1c1
Sequence:CCGGCGAGAATATCTGATTGGTCTTCTCGAGAAGACCAATCAGATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-1431s1c1
Sequence:CCGGCCGGATACGTTTATTCAGCTTCTCGAGAAGCTGAATAAACGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-450s1c1
Sequence:CCGGGCCTATCTGGATGTTCGTATACTCGAGTATACGAACATCCAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-617s1c1
Sequence:CCGGGCCTGTTCATAAAGTTGGAAACTCGAGTTTCCAACTTTATGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-1072s1c1
Sequence:CCGGCCATCCTTATTGGAGATCCAACTCGAGTTGGATCTCCAATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021151
VALIDATED
CROT MISSION shRNA Lentiviral Transduction Particles
carnitine O-octanoyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-583s21c1
Sequence:GTACCGGTGAACTACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021151.2-2353s21c1
Sequence:CCGGTGGTACTTACATGGGTTATAACTCGAGTTATAACCCATGTAAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1425s21c1
Sequence:CCGGCTTCACCCGGATACGTTTATTCTCGAGAATAAACGTATCCGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-1036s21c1
Sequence:CCGGATGTAACACCAGAGGATTATTCTCGAGAATAATCCTCTGGTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021151.2-994s21c1
Sequence:CCGGAGAGTAGTTTACTGGTATATTCTCGAGAATATACCAGTAAACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-939s1c1
Sequence:CCGGCGAGAATATCTGATTGGTCTTCTCGAGAAGACCAATCAGATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-1431s1c1
Sequence:CCGGCCGGATACGTTTATTCAGCTTCTCGAGAAGCTGAATAAACGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_021151.2-450s1c1
Sequence:CCGGGCCTATCTGGATGTTCGTATACTCGAGTATACGAACATCCAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-617s1c1
Sequence:CCGGGCCTGTTCATAAAGTTGGAAACTCGAGTTTCCAACTTTATGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021151.2-1072s1c1
Sequence:CCGGCCATCCTTATTGGAGATCCAACTCGAGTTGGATCTCCAATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks