EMAIL THIS PAGE TO A FRIEND

CRTAC1

cartilage acidic protein 1

52 Gene Product Result for
Synonyms: ASPIC ASPIC1 CEP-68
Gene ID:
Human(55118) Summary: This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(72832) cartilage acidic protein 1
Rat(171438) cartilage acidic protein 1
chicken(425346) cartilage acidic protein 1
dog(608827) cartilage acidic protein 1
domestic cat(101082013) cartilage acidic protein 1
Horse(100060874) cartilage acidic protein 1
cow(100139581) cartilage acidic protein 1
domestic guinea pig(100716602) cartilage acidic protein 1
naked mole-rat(101706796) cartilage acidic protein 1
sheep(101110105) cartilage acidic protein 1
Domestic Rabbit(100352703) cartilage acidic protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1397 Human CRTAC1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018058 Rosetta Predictions human pricing
NM_134401 Rosetta Predictions rat pricing
NM_145123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057909 predicted 1941
2 SASI_Hs01_00057910 predicted 1108
3 SASI_Hs01_00057911 predicted 935
4 SASI_Hs01_00057912 predicted 778
5 SASI_Hs02_00351194 predicted 1268
6 SASI_Hs01_00057913 predicted 818
7 SASI_Hs01_00057914 predicted 509
8 SASI_Hs01_00057915 predicted 1259
9 SASI_Hs01_00057916 predicted 1876
10 SASI_Hs01_00057917 predicted 793
11 SASI_Hs01_00057918 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267985 predicted 1872
2 SASI_Rn02_00267986 predicted 1396
3 SASI_Rn02_00267987 predicted 669
4 SASI_Rn02_00267988 predicted 532
5 SASI_Rn02_00267989 predicted 474
6 SASI_Rn02_00267990 predicted 1266
7 SASI_Rn02_00267991 predicted 1087
8 SASI_Rn02_00267992 predicted 981
9 SASI_Rn02_00267993 predicted 1076
10 SASI_Rn02_00267994 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121129 predicted 939
2 SASI_Mm01_00121130 predicted 733
3 SASI_Mm01_00121133 predicted 722
4 SASI_Mm01_00121134 predicted 1831
5 SASI_Mm01_00121135 predicted 536
6 SASI_Mm01_00121136 predicted 1454
7 SASI_Mm01_00121137 predicted 415
8 SASI_Mm01_00121138 predicted 1042
9 SASI_Mm02_00340506 predicted 711
10 SASI_Mm02_00340507 predicted 459
11 SASI_Mm01_00121131 predicted 1076
12 SASI_Mm01_00121132 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018058
VALIDATED
CRTAC1 MISSION shRNA Bacterial Glycerol Stock
cartilage acidic protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018058.4-747s21c1
Sequence:CCGGTACTTCCTCAACACCAATAATCTCGAGATTATTGGTGTTGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2411s21c1
Sequence:CCGGCCTAGACAGTAGGGATGTAAACTCGAGTTTACATCCCTACTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2459s21c1
Sequence:CCGGCCATCCATGCACATTACTTAGCTCGAGCTAAGTAATGTGCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-750s1c1
Sequence:CCGGCGACAATGAGAATGGGCCTAACTCGAGTTAGGCCCATTCTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018058.2-549s1c1
Sequence:CCGGCTCTATCTACATTGCCAATTACTCGAGTAATTGGCAATGTAGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-411s1c1
Sequence:CCGGCACCGACAAGTTGTTCAAGTTCTCGAGAACTTGAACAACTTGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-1642s1c1
Sequence:CCGGCATTGCATGGACACCAATGAACTCGAGTTCATTGGTGTCCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-151s1c1
Sequence:CCGGGCAGTTACTGATGTGGACCATCTCGAGATGGTCCACATCAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018058
VALIDATED
CRTAC1 MISSION shRNA shRNA Plasmid DNA
cartilage acidic protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018058.4-747s21c1
Sequence:CCGGTACTTCCTCAACACCAATAATCTCGAGATTATTGGTGTTGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2411s21c1
Sequence:CCGGCCTAGACAGTAGGGATGTAAACTCGAGTTTACATCCCTACTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2459s21c1
Sequence:CCGGCCATCCATGCACATTACTTAGCTCGAGCTAAGTAATGTGCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-750s1c1
Sequence:CCGGCGACAATGAGAATGGGCCTAACTCGAGTTAGGCCCATTCTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018058.2-549s1c1
Sequence:CCGGCTCTATCTACATTGCCAATTACTCGAGTAATTGGCAATGTAGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-411s1c1
Sequence:CCGGCACCGACAAGTTGTTCAAGTTCTCGAGAACTTGAACAACTTGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-1642s1c1
Sequence:CCGGCATTGCATGGACACCAATGAACTCGAGTTCATTGGTGTCCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-151s1c1
Sequence:CCGGGCAGTTACTGATGTGGACCATCTCGAGATGGTCCACATCAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018058
VALIDATED
CRTAC1 MISSION shRNA Lentiviral Transduction Particles
cartilage acidic protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018058.4-747s21c1
Sequence:CCGGTACTTCCTCAACACCAATAATCTCGAGATTATTGGTGTTGAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2411s21c1
Sequence:CCGGCCTAGACAGTAGGGATGTAAACTCGAGTTTACATCCCTACTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018058.4-2459s21c1
Sequence:CCGGCCATCCATGCACATTACTTAGCTCGAGCTAAGTAATGTGCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-750s1c1
Sequence:CCGGCGACAATGAGAATGGGCCTAACTCGAGTTAGGCCCATTCTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018058.2-549s1c1
Sequence:CCGGCTCTATCTACATTGCCAATTACTCGAGTAATTGGCAATGTAGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-411s1c1
Sequence:CCGGCACCGACAAGTTGTTCAAGTTCTCGAGAACTTGAACAACTTGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-1642s1c1
Sequence:CCGGCATTGCATGGACACCAATGAACTCGAGTTCATTGGTGTCCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018058.2-151s1c1
Sequence:CCGGGCAGTTACTGATGTGGACCATCTCGAGATGGTCCACATCAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145123
CRTAC1 MISSION shRNA Bacterial Glycerol Stock
cartilage acidic protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145123.2-2136s1c1
Sequence:CCGGGAAGCCTTTCTTTGCATGTTTCTCGAGAAACATGCAAAGAAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1741s1c1
Sequence:CCGGCCCGTATGTGTCAACACCTATCTCGAGATAGGTGTTGACACATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-582s1c1
Sequence:CCGGTGGAGGATACTCTATCTACATCTCGAGATGTAGATAGAGTATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-408s1c1
Sequence:CCGGCTACTTTCTCAACACCAATAACTCGAGTTATTGGTGTTGAGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1935s1c1
Sequence:CCGGCCTTCAGTTATATGCACTTTACTCGAGTAAAGTGCATATAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145123
CRTAC1 MISSION shRNA shRNA Plasmid DNA
cartilage acidic protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145123.2-2136s1c1
Sequence:CCGGGAAGCCTTTCTTTGCATGTTTCTCGAGAAACATGCAAAGAAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1741s1c1
Sequence:CCGGCCCGTATGTGTCAACACCTATCTCGAGATAGGTGTTGACACATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-582s1c1
Sequence:CCGGTGGAGGATACTCTATCTACATCTCGAGATGTAGATAGAGTATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-408s1c1
Sequence:CCGGCTACTTTCTCAACACCAATAACTCGAGTTATTGGTGTTGAGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1935s1c1
Sequence:CCGGCCTTCAGTTATATGCACTTTACTCGAGTAAAGTGCATATAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145123
CRTAC1 MISSION shRNA Lentiviral Transduction Particles
cartilage acidic protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145123.2-2136s1c1
Sequence:CCGGGAAGCCTTTCTTTGCATGTTTCTCGAGAAACATGCAAAGAAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1741s1c1
Sequence:CCGGCCCGTATGTGTCAACACCTATCTCGAGATAGGTGTTGACACATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-582s1c1
Sequence:CCGGTGGAGGATACTCTATCTACATCTCGAGATGTAGATAGAGTATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-408s1c1
Sequence:CCGGCTACTTTCTCAACACCAATAACTCGAGTTATTGGTGTTGAGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145123.2-1935s1c1
Sequence:CCGGCCTTCAGTTATATGCACTTTACTCGAGTAAAGTGCATATAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks